LOC558232

Ensembl ID:
ENSDARG00000079366
Mouse Orthologue:
Ppp1r9b
Mouse Description:
protein phosphatase 1, regulatory subunit 9B Gene [Source:MGI Symbol;Acc:MGI:2387581]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38384 Nonsense Mutation detected in F1 DNA During 2016
sa33157 Nonsense Mutation detected in F1 DNA During 2016
sa15198 Essential Splice Site Available for shipment Available now
sa33158 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38384
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114190 Nonsense 414 803 1 10
Genomic Location:
Chromosome 3 (position 23543060)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGGCAGTCAGCTGGATGACGATGAGGAAGCTGAGGATGATGATGCTTA[C/A]GAACCTGAATCCAGCTGTTCAGAAATCCCAGGACTGCCTGCGGAAGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33157
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114190 Nonsense 472 803 2 10
Genomic Location:
Chromosome 3 (position 23593588)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGACAGACGCAATGACGAGGTGGACCCCATGGCTGCTTCAGCCGAGTA[T/A]GAGCTGGAGAAGAGGGTGGAGAGACTGGATCTGTTCCCAGTGGAGCTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15198
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114190 Essential Splice Site 754 803 8 10
Genomic Location:
Chromosome 3 (position 23609831)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCGCAAGTACARCAAAGCCAAACGCCTCATCAAAGAGTACCAGCAAAA[G/T]TGAGYGAGAGATTGTGAAGTCATACCTACAACATTGATTGTAAAGGAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33158
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114190 Nonsense 759 803 9 10
Genomic Location:
Chromosome 3 (position 23611725)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGATTAAACTGTGTTGTGTGTGTGTTAATGCAGGGAGATTGAGTATT[T/G]AAAGAAGGAGACAGCACAGCGCAGAGCACAAGAGGAGACTGAGGCCAGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link