LOC558232

Ensembl ID:
ENSDARG00000079366
Mouse Orthologue:
Ppp1r9b
Mouse Description:
protein phosphatase 1, regulatory subunit 9B Gene [Source:MGI Symbol;Acc:MGI:2387581]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa15198 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15198
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114190 Essential Splice Site 754 803 8 10
Genomic Location:
Chromosome 3 (position 23609831)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCGCAAGTACARCAAAGCCAAACGCCTCATCAAAGAGTACCAGCAAAA[G/T]TGAGYGAGAGATTGTGAAGTCATACCTACAACATTGATTGTAAAGGAATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/asiub2dd