LRIG3

Ensembl ID:
ENSDARG00000079363
Description:
leucine-rich repeats and immunoglobulin-like domains 3 [Source:HGNC Symbol;Acc:30991]
Human Orthologue:
LRIG3
Human Description:
leucine-rich repeats and immunoglobulin-like domains 3 [Source:HGNC Symbol;Acc:30991]
Mouse Orthologue:
Lrig3
Mouse Description:
leucine-rich repeats and immunoglobulin-like domains 3 Gene [Source:MGI Symbol;Acc:MGI:2443955]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39025 Essential Splice Site Mutation detected in F1 DNA During 2016
sa7233 Nonsense Mutation detected in F1 DNA During 2016
sa12526 Nonsense Available for shipment Available now
sa7234 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa39025
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110613 Essential Splice Site 264 913 6 22
Genomic Location (Zv9):
Chromosome 15 (position 3027575)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3002582
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGAGGACATGAACGGCCCCTTCTCTGCTCTGGACAACCTGCGCAAACT[G/A]TACGCTTCCACAAACTCCATTAGTTTTTAATCTGAATTGTTGTAAATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7233
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110613 Nonsense 801 913 20 22
Genomic Location (Zv9):
Chromosome 15 (position 3035384)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3010391
KASP Assay ID:
554-5045.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RATCRCTGATTGGCTCCTATGCCAGAAGGYGGGCTTTAKTTGCCATATAT[C/T]GATCGCTGATTRGCTCCTATGCCAGAAGGYGGGCTTTATTTGCCATATAK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12526
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110613 Nonsense 801 913 20 22
Genomic Location (Zv9):
Chromosome 15 (position 3035384)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3010391
KASP Assay ID:
554-5045.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
RATCRCTGATTGGCTCCTATGCCAGAAGGYGGGCTTTWKTTGCCATATAT[C/T]GATCGCTGATTRGCTCCTATGCCAGAAGGYGGGCTTTATTTGCCATATAK
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7234
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110613 Nonsense 818 913 20 22
Genomic Location (Zv9):
Chromosome 15 (position 3035435)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 3010442
KASP Assay ID:
554-5046.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCGCTGATTRGCTCCTATGCCAGAAGGYGGGCTTTATTTGCCATATAK[C/T]GATCRCTGATTGGCTCCTGTACTASAANGGCGGGGCTTTTCARTTGTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Heart failure: Association of genome-wide variation with the risk of incident heart failure in adults of European and African ancestry: a prospective meta-analysis from the cohorts for heart and aging research in genomic epidemiology (CHARGE) consortium. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link