si:ch73-312h4.1

Ensembl ID:
ENSDARG00000079355
ZFIN IDs:
ZDB-GENE-070705-267, ZDB-GENE-080327-23
Description:
fibronectin leucine rich transmembrane protein 2-like [Source:RefSeq peptide;Acc:NP_001093513]
Human Orthologue:
FLRT2
Human Description:
fibronectin leucine rich transmembrane protein 2 [Source:HGNC Symbol;Acc:3761]
Mouse Orthologue:
Flrt2
Mouse Description:
fibronectin leucine rich transmembrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:3603594]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32278 Nonsense Available for shipment Available now
sa1468 Nonsense Available for shipment Available now
sa43394 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32278
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112385 Nonsense 137 662 1 1
Genomic Location (Zv9):
Chromosome 20 (position 11287921)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 11107114
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCCAGACCATTTCCAGGGCAGCACTTGCCCAGCTACACATGCTGGAG[G/T]AACTCCACCTGGATGACAACTCCATCTCAACTGTAGGGGTAGAGGAGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1468
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112385 Nonsense 474 662 1 1
Genomic Location (Zv9):
Chromosome 20 (position 11286910)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 11106103
KASP Assay ID:
554-1393.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACTTGGGTTAAGATGGGCCAAAGTTTGATGAGTGACATTACTCGAGAA[A/T]GAACAGTCCCTGGATACCAACGAAGGCTTAGTTTGTCAAATCTGGAGCCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa43394
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112385 Nonsense 519 662 1 1
Genomic Location (Zv9):
Chromosome 20 (position 11286775)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 11105968
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACTCTTAATACTTACAGACCGGGCGAGGATACTATCTGTTCTGAGGCT[A/T]AGACAAAATCCACATCCACATACTCTGAATCGGAGCAGGCTGCTCAGCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link