si:ch73-312h4.1

Ensembl ID:
ENSDARG00000079355
ZFIN IDs:
ZDB-GENE-070705-267, ZDB-GENE-080327-23
Description:
fibronectin leucine rich transmembrane protein 2-like [Source:RefSeq peptide;Acc:NP_001093513]
Human Orthologue:
FLRT2
Human Description:
fibronectin leucine rich transmembrane protein 2 [Source:HGNC Symbol;Acc:3761]
Mouse Orthologue:
Flrt2
Mouse Description:
fibronectin leucine rich transmembrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:3603594]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32278 Nonsense Available for shipment Available now
sa45691 Nonsense Mutation detected in F1 DNA During 2018
sa1468 Nonsense Available for shipment Available now
sa43394 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32278
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112385 Nonsense 137 662 1 1
Genomic Location (Zv9):
Chromosome 20 (position 11287921)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 11107114
GRCz11 20 11105288
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCCAGACCATTTCCAGGGCAGCACTTGCCCAGCTACACATGCTGGAG[G/T]AACTCCACCTGGATGACAACTCCATCTCAACTGTAGGGGTAGAGGAGGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45691
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112385 Nonsense 340 662 1 1
Genomic Location (Zv9):
Chromosome 20 (position 11287312)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 11106505
GRCz11 20 11104679
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGGCTCAGGTCTCTGCCTTCTGCGATAAATGTCCGTGGGTTTACGTGC[C/T]AGAGTCCAGAAAGAGTGCGTGGTATGGTTATACGAGAGCTCACTTTAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1468
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112385 Nonsense 474 662 1 1
Genomic Location (Zv9):
Chromosome 20 (position 11286910)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 11106103
GRCz11 20 11104277
KASP Assay ID:
554-1393.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACTTGGGTTAAGATGGGCCAAAGTTTGATGAGTGACATTACTCGAGAA[A/T]GAACAGTCCCTGGATACCAACGAAGGCTTAGTTTGTCAAATCTGGAGCCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa43394
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112385 Nonsense 519 662 1 1
Genomic Location (Zv9):
Chromosome 20 (position 11286775)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 11105968
GRCz11 20 11104142
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACTCTTAATACTTACAGACCGGGCGAGGATACTATCTGTTCTGAGGCT[A/T]AGACAAAATCCACATCCACATACTCTGAATCGGAGCAGGCTGCTCAGCAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link