sap130b

Ensembl ID:
ENSDARG00000079352
ZFIN ID:
ZDB-GENE-070912-570
Description:
Novel protein similar to vertebrate Sin3A-associated protein, 130kDa (SAP130) [Source:UniProtKB/TrEM
Human Orthologue:
SAP130
Human Description:
Sin3A-associated protein, 130kDa [Source:HGNC Symbol;Acc:29813]
Mouse Orthologue:
Sap130
Mouse Description:
Sin3A associated protein Gene [Source:MGI Symbol;Acc:MGI:1919782]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31276 Nonsense Available for shipment Available now
sa31275 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31276
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065266 Nonsense 822 1051 17 21
ENSDART00000143412 Nonsense 814 1043 17 21

The following transcripts of ENSDARG00000079352 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 22401492)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23288197
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACCTCATTCCTCTCAGTGGCCTTAGGGCCAAACAGTGGTGCACAGATGT[T/A]GACAGTGCCTCCTACAGACCTCACGCTTGGAGCTTCACCCAGAAAGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31275
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065266 Essential Splice Site 884 1051 17 21
ENSDART00000143412 Essential Splice Site 876 1043 17 21

The following transcripts of ENSDARG00000079352 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 22401303)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23288008
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCAGCCAACGGGCTGAGAAACGCAAGTCCCCTCCTAAAGAATACATCG[G/T]TAAGATTCATCATTATAAAGCTGCATTCAACAGTGATTAACTTTATTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link