E2F1

Ensembl ID:
ENSDARG00000079349
Description:
E2F transcription factor 1 [Source:HGNC Symbol;Acc:3113]
Human Orthologue:
E2F1
Human Description:
E2F transcription factor 1 [Source:HGNC Symbol;Acc:3113]
Mouse Orthologue:
E2f1
Mouse Description:
E2F transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:101941]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44434 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30528 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44434
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109944 Essential Splice Site 189 433 3 7
Genomic Location (Zv9):
Chromosome Zv9_NA947 (position 15405)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43586234
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGGCATTCACTTAATCTCCAAGAAGTCCAAGAACAACATCCAGTGGCT[G/T]TGAGTCTTTCAGAACGTTACTGCTTTATATAAATGTGGAGTGTAGTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30528
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109944 Nonsense 241 433 4 7
Genomic Location (Zv9):
Chromosome Zv9_NA947 (position 12956)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43583785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGTTTACAGCTACGGCTCCTCACTGAGGACACACACAACAAGAAATA[T/G]CCTTTACCTGCACAGTGTTAGTGGCGTCACGATCGCCTCACAACAAGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link