E2F1

Ensembl ID:
ENSDARG00000079349
Description:
E2F transcription factor 1 [Source:HGNC Symbol;Acc:3113]
Human Orthologue:
E2F1
Human Description:
E2F transcription factor 1 [Source:HGNC Symbol;Acc:3113]
Mouse Orthologue:
E2f1
Mouse Description:
E2F transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:101941]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44434 Essential Splice Site Mutation detected in F1 DNA During 2017
sa30528 Nonsense Mutation detected in F1 DNA During 2017
sa45025 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44434
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109944 Essential Splice Site 189 433 3 7
Genomic Location (Zv9):
Chromosome Zv9_NA947 (position 15405)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43586234
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGGCATTCACTTAATCTCCAAGAAGTCCAAGAACAACATCCAGTGGCT[G/T]TGAGTCTTTCAGAACGTTACTGCTTTATATAAATGTGGAGTGTAGTTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30528
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109944 Nonsense 241 433 4 7
Genomic Location (Zv9):
Chromosome Zv9_NA947 (position 12956)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 43583785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGTTTACAGCTACGGCTCCTCACTGAGGACACACACAACAAGAAATA[T/G]CCTTTACCTGCACAGTGTTAGTGGCGTCACGATCGCCTCACAACAAGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45025
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109944 Nonsense 423 433 7 7
Genomic Location (Zv9):
Chromosome Zv9_NA947 (position 4639)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCACTTCGGCCTGGAGGATCATGAGGGCGTCAGTGAGCTGTTCGACTG[C/A]GACTTCAGTGACCTCGTCCCTCTGGAGTTCTGATGGACGCATCCGAGTGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link