GRIN2B (2 of 2)

Ensembl ID:
ENSDARG00000079348
Description:
glutamate receptor, ionotropic, N-methyl D-aspartate 2B [Source:HGNC Symbol;Acc:4586]
Human Orthologue:
GRIN2B
Human Description:
glutamate receptor, ionotropic, N-methyl D-aspartate 2B [Source:HGNC Symbol;Acc:4586]
Mouse Orthologue:
Grin2b
Mouse Description:
glutamate receptor, ionotropic, NMDA2B (epsilon 2) Gene [Source:MGI Symbol;Acc:MGI:95821]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19927 Nonsense Mutation detected in F1 DNA During 2017
sa25970 Nonsense Mutation detected in F1 DNA During 2017
sa33073 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19927
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047094 Nonsense 201 1263 7 25
Genomic Location (Zv9):
Chromosome 3 (position 2077361)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1544538
KASP Assay ID:
2259-2928.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTGGGTAAGTGGGAGAACGGCTCTCTCTCCATGAAGTATCACGTGTG[G/A]CCGAGGTTTGAGCTGTACTCTGGGCCGGAGGCTCGTGAGGACGATCATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25970
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047094 Nonsense 314 1263 9 25
Genomic Location (Zv9):
Chromosome 3 (position 2076596)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1543773
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACACGGCAAGAAGATCAACGGCACCTGGAACGGCATGGTGGGAGAGGTA[C/T]GAGAGTGTGTGTGTGTGTGTGATCTTCACTATCTGCTGCAGGCCTCTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047094 Essential Splice Site 485 1263 14 25
Genomic Location (Zv9):
Chromosome 3 (position 2074295)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 1541472
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGGAGATGGGCCATTCGTTTGTTTGCTCACTCTGTGTTTGGTCTTCA[G/A]TTTCAGAATCCCAATGATTTCTCTCCTCCGTTTCGCTTCGGGACGGTCCC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link