LOC555258

Ensembl ID:
ENSDARG00000079340
Human Orthologues:
SLC47A1, SLC47A2
Human Descriptions:
solute carrier family 47, member 1 [Source:HGNC Symbol;Acc:25588]
solute carrier family 47, member 2 [Source:HGNC Symbol;Acc:26439]
Mouse Orthologues:
Slc47a1, Slc47a2
Mouse Descriptions:
solute carrier family 47, member 1 Gene [Source:MGI Symbol;Acc:MGI:1914723]
solute carrier family 47, member 2 Gene [Source:MGI Symbol;Acc:MGI:3588190]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5881 Nonsense Mutation detected in F1 DNA During 2014
sa9619 Essential Splice Site Available for shipment Available now
sa6380 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5881
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087632 Nonsense 12 607 1 17
Genomic Location:
Chromosome 15 (position 25972919)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCTGAGAAGAAGATCATGGACGTCTCCAGTCCTGGAACYGACAATTTGT[C/A]AATGGAGCCCAGYGCCAAGCTGTTTTGCTGTGGTTTCATGAGGCGTTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9619
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087632 Essential Splice Site 168 607 5 17
Genomic Location:
Chromosome 15 (position 25966571)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTAGGATTGCACAGCTTTATGTGGTGGTTTATTTGCCAGCAATTCCAG[T/C]AAGGTTCACTAGTGGATGATTATRGGTTGCATTTTCAGCTTACCTTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6380
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000087632 Nonsense 179 607 6 17
Genomic Location:
Chromosome 15 (position 25966431)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGTTTCTATACTACAGGCYATGTTTCTGTATCAGCTGCAGCTGTCATA[T/A]CTTCAGAACCAGGTACATAAAATATACATTTAAGAAACTGAACAAAGCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kr1c94mf