LOC100330369

Ensembl ID:
ENSDARG00000079332
Human Orthologue:
ENDOD1
Human Description:
endonuclease domain containing 1 [Source:HGNC Symbol;Acc:29129]
Mouse Orthologue:
Endod1
Mouse Description:
endonuclease domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1919196]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25522 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25522
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109218 Essential Splice Site 91 263 1 2
Genomic Location (Zv9):
Chromosome 1 (position 7694122)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 7933927
KASP Assay ID:
2259-0164.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGGGCTAATGGGCTGCACAAGACTAAACAGCTGGTACATTGAACCTCAG[G/A]TAAGTGAAATATCACTCAAACTTAATTCTCCTAAAGGTTTCACACTCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link