ENSDARG00000079330

Ensembl ID:
ENSDARG00000079330
Mouse Orthologue:
Emid2
Mouse Description:
EMI domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2155345]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13038 Nonsense Available for shipment Available now
sa6179 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa13038
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079026 Nonsense 17 311 1 11
ENSDART00000079034 Nonsense 17 312 1 11
Genomic Location:
Chromosome 10 (position 34192030)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGGAACTGGTGCCAGTTCACAGTACAGAAGACCRTTTCATGCCAGACA[C/T]AAAATGGGACTGAGACTGTTGTGCAGCGACTGTTTCAGAGCTGCCGATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6179
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079026 Nonsense 227 311 7 11
ENSDART00000079034 None None 312 None 11
Genomic Location:
Chromosome 10 (position 34151214)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGATCAGATAATTGGCAAAACAGCAAAAATAGACAATATAACAAAATAT[T/G]AACTTAAATTTTTTTTCAAACTGCTATTTGGGATCTATTATTCTATAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3gzfhx5v