si:ch73-353p21.4

Ensembl ID:
ENSDARG00000079328
ZFIN ID:
ZDB-GENE-091204-417
Human Orthologues:
ERCC6, PGBD1, PGBD2, PGBD3, PGBD4
Human Descriptions:
excision repair cross-complementing rodent repair deficiency, complementation group 6 [Source:HGNC S
piggyBac transposable element derived 1 [Source:HGNC Symbol;Acc:19398]
piggyBac transposable element derived 2 [Source:HGNC Symbol;Acc:19399]
piggyBac transposable element derived 3 [Source:HGNC Symbol;Acc:19400]
piggyBac transposable element derived 4 [Source:HGNC Symbol;Acc:19401]
Mouse Orthologue:
Pgbd1
Mouse Description:
piggyBac transposable element derived 1 Gene [Source:MGI Symbol;Acc:MGI:2441675]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa649 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa649
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110526   None 468 None 4
ENSDART00000140905 Nonsense 614 626 3 3
Genomic Location (Zv9):
Chromosome 22 (position 5644251)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 5690318
KASP Assay ID:
554-0557.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCATTGTGCCTTGTTTCAAATCGCAACTGTTACGTTAAGTGGCATGAA[C/T]AAGATAGTGATAGCGAGGAGGANNNTGACGATGATGACGASTGAAGCTCCAAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link