hmcn2

Ensembl ID:
ENSDARG00000079327
ZFIN ID:
ZDB-GENE-030131-9765
Human Orthologues:
HMCN2, RP11-88G17.6
Human Descriptions:
hemicentin 2 [Source:HGNC Symbol;Acc:21293]
Novel protein similar to hemicentin (LOC392395) [Source:UniProtKB/TrEMBL;Acc:A2A3K3]
Mouse Orthologue:
Hmcn2
Mouse Description:
hemicentin 2 Gene [Source:MGI Symbol;Acc:MGI:2677838]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31666 Nonsense Mutation detected in F1 DNA During 2016
sa34441 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41253 Nonsense Mutation detected in F1 DNA During 2016
sa7144 Nonsense Mutation detected in F1 DNA During 2016
sa27237 Essential Splice Site Mutation detected in F1 DNA During 2016
sa34442 Nonsense Mutation detected in F1 DNA During 2016
sa16664 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31666
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112067 Nonsense 217 2925 5 56
ENSDART00000137897   None 815 None 15
ENSDART00000138117   None 89 None 3
ENSDART00000142824   None 122 None 2
ENSDART00000145362   None 158 None 4
ENSDART00000147594   None 294 None 6
Genomic Location (Zv9):
Chromosome 8 (position 33557218)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 32699944
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGCAGGTGTTGAGGGTTAAGTCTGTCAGGCCTAGGGATCGTGGCCTGTA[T/G]CAGTGTGTGGCGACAAACAACGCTGGGACTCAGACAAGACAGTTCAGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34441
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112067 Essential Splice Site 237 2925 5 56
ENSDART00000137897   None 815 None 15
ENSDART00000138117   None 89 None 3
ENSDART00000142824   None 122 None 2
ENSDART00000145362   None 158 None 4
ENSDART00000147594   None 294 None 6
Genomic Location (Zv9):
Chromosome 8 (position 33557280)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 32700006
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAAACAACGCTGGGACTCAGACAAGACAGTTCAGGCTGACCATACAAG[G/A]TAAGCCATTGGGATGGAACTAATAATGAATTCTAGTCTCCACATTCCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41253
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112067 Nonsense 631 2925 12 56
ENSDART00000137897   None 815 None 15
ENSDART00000138117   None 89 None 3
ENSDART00000142824   None 122 None 2
ENSDART00000145362   None 158 None 4
ENSDART00000147594   None 294 None 6
Genomic Location (Zv9):
Chromosome 8 (position 33565407)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 32708133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGATGGAGCCAGTTATCAGTGTGTGGCAGAGAATAAAGCTGGAGCTGTC[G/T]AGAGACTTTACAGCTTGTCTATTCAAGGTAAGAGCAACTGACAGAGTTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7144
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112067 Nonsense 1732 2925 35 56
ENSDART00000137897   None 815 None 15
ENSDART00000138117   None 89 None 3
ENSDART00000142824 Nonsense 18 122 1 2
ENSDART00000145362   None 158 None 4
ENSDART00000147594   None 294 None 6
Genomic Location (Zv9):
Chromosome 8 (position 33595703)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 32738429
KASP Assay ID:
554-4587.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTTCACGTGTTACTCTTGGAGATGCAGGAACATATCAGTGTTTAGCA[C/T]AGAATGAAGCAGGAACAGCTTTGGCACAAACCCAGCTTATAKTRCAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27237
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112067 Essential Splice Site 2303 2925 45 56
ENSDART00000137897 Essential Splice Site 193 815 4 15
ENSDART00000138117   None 89 None 3
ENSDART00000142824   None 122 None 2
ENSDART00000145362   None 158 None 4
ENSDART00000147594   None 294 None 6
Genomic Location (Zv9):
Chromosome 8 (position 33605729)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 32748455
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGGATTTGTTCCTCCTATGCTTTTGTCCTCTAATCTCAATCTACAGG[T/G]AAGTTTTTCAAACTCAAATGTGTAAAGTAAATCTCAGCAGGCATTACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34442
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112067 Nonsense 2323 2925 46 56
ENSDART00000137897 Nonsense 213 815 5 15
ENSDART00000138117   None 89 None 3
ENSDART00000142824   None 122 None 2
ENSDART00000145362   None 158 None 4
ENSDART00000147594   None 294 None 6
Genomic Location (Zv9):
Chromosome 8 (position 33606670)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 32749396
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGAGTCGTATGTGCAGACAGGCTCTGGGCAGCTTTATTCCTGGTCCACA[C/T]AGAATCACATTCGGGACGGGGCTCCTCTTACCCTGCGCTGCAATCATACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16664
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112067 Nonsense 2885 2925 56 56
ENSDART00000137897 Nonsense 775 815 15 15
ENSDART00000138117   None 89 None 3
ENSDART00000142824   None 122 None 2
ENSDART00000145362   None 158 None 4
ENSDART00000147594   None 294 None 6
Genomic Location (Zv9):
Chromosome 8 (position 33632787)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 32775513
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCATTTGGCATCAAGGATGAAGCAGGAAGAGGCATCATTTTCACAGTR[A/T]AGCCTTTAGACTGGCCAGGCCTGGTGCGACTTSGGGTACAAGCCACAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link