hmcn2

Ensembl ID:
ENSDARG00000079327
ZFIN ID:
ZDB-GENE-030131-9765
Human Orthologues:
HMCN2, RP11-88G17.6
Human Descriptions:
hemicentin 2 [Source:HGNC Symbol;Acc:21293]
Novel protein similar to hemicentin (LOC392395) [Source:UniProtKB/TrEMBL;Acc:A2A3K3]
Mouse Orthologue:
Hmcn2
Mouse Description:
hemicentin 2 Gene [Source:MGI Symbol;Acc:MGI:2677838]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7144 Nonsense Mutation detected in F1 DNA During 2014
sa16664 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7144
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112067 Nonsense 1732 2925 35 56
ENSDART00000137897 None None 815 None 15
ENSDART00000138117 None None 89 None 3
ENSDART00000142824 Nonsense 18 122 1 2
ENSDART00000145362 None None 158 None 4
ENSDART00000147594 None None 294 None 6
Genomic Location:
Chromosome 8 (position 33595703)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTTTCACGTGTTACTCTTGGAGATGCAGGAACATATCAGTGTTTAGCA[C/T]AGAATGAAGCAGGAACAGCTTTGGCACAAACCCAGCTTATAKTRCAAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16664
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112067 Nonsense 2885 2925 56 56
ENSDART00000137897 Nonsense 775 815 15 15
ENSDART00000138117 None None 89 None 3
ENSDART00000142824 None None 122 None 2
ENSDART00000145362 None None 158 None 4
ENSDART00000147594 None None 294 None 6
Genomic Location:
Chromosome 8 (position 33632787)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCATTTGGCATCAAGGATGAAGCAGGAAGAGGCATCATTTTCACAGTR[A/T]AGCCTTTAGACTGGCCAGGCCTGGTGCGACTTSGGGTACAAGCCACAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5o77n3yy