cabin1

Ensembl ID:
ENSDARG00000079326
ZFIN IDs:
ZDB-GENE-030131-1735, ZDB-GENE-030131-1735, ZDB-GENE-081104-237
Description:
Novel protein similar to H.sapiens CABIN1, calcineurin binding protein 1 (CABIN1) [Source:UniProtKB/
Human Orthologue:
CABIN1
Human Description:
calcineurin binding protein 1 [Source:HGNC Symbol;Acc:24187]
Mouse Orthologue:
Cabin1
Mouse Description:
calcineurin binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1298375]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21396 Nonsense Available for shipment Available now
sa3660 Nonsense Mutation detected in F1 DNA During 2014
sa7162 Nonsense Mutation detected in F1 DNA During 2014
sa18932 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21396
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109785 Nonsense 170 2284 5 38
ENSDART00000147417 Nonsense 170 1279 6 25
Genomic Location:
Chromosome 8 (position 54206553)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAACCCGGAGCACTGGCCGTGTCTGGACAGCCTCATCACAGTCCTGTA[C/A]GCGCTCAGTGACTACAGCTGTGAGTATCTATAATCTATTTTTTTTAGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3660
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109785 Nonsense 285 2284 8 38
ENSDART00000147417 Nonsense 285 1279 9 25
Genomic Location:
Chromosome 8 (position 54200260)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATAGGTGGAAGAGTGTGGGAGAGAGTTTCCTGGCCATGTACAAACAC[C/T]AGAACGCTTGTCTGGTGCCTCGGCCTGACTTTGGCCGTCGGATTGATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7162
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109785 Nonsense 971 2284 19 38
ENSDART00000147417 Nonsense 970 1279 20 25
Genomic Location:
Chromosome 8 (position 54178932)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCTTATAAAGAGGATCTGGAGATGGCACTCGAGCAGTGTTTCTTCTG[T/A]CTGTAYGCSTACCCCAGCAAGAAGAGCAAAGCCCGATATCTGGAGGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18932
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109785 Essential Splice Site 1741 2284 31 38
ENSDART00000147417 None None 1279 None 25
Genomic Location:
Chromosome 8 (position 54108898)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTACTCAAAATCTCCCTCATGCTTCAGAGAACCCCCGACCAGGGAAA[G/A]TAAGACCACTGACTATAATACATTTGTTCAGTGTTTGCATATTTAGAACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3rdidw1e