cabin1

Ensembl ID:
ENSDARG00000079326
ZFIN IDs:
ZDB-GENE-030131-1735, ZDB-GENE-030131-1735, ZDB-GENE-081104-237
Description:
Novel protein similar to H.sapiens CABIN1, calcineurin binding protein 1 (CABIN1) [Source:UniProtKB/
Human Orthologue:
CABIN1
Human Description:
calcineurin binding protein 1 [Source:HGNC Symbol;Acc:24187]
Mouse Orthologue:
Cabin1
Mouse Description:
calcineurin binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1298375]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21396 Nonsense Available for shipment Available now
sa34512 Nonsense Mutation detected in F1 DNA During 2016
sa41306 Nonsense Mutation detected in F1 DNA During 2016
sa7162 Nonsense Mutation detected in F1 DNA During 2016
sa18932 Essential Splice Site Mutation detected in F1 DNA During 2016
sa41305 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa21396
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109785 Nonsense 170 2284 5 38
ENSDART00000147417 Nonsense 170 1279 6 25
Genomic Location (Zv9):
Chromosome 8 (position 54206553)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51941912
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAACCCGGAGCACTGGCCGTGTCTGGACAGCCTCATCACAGTCCTGTA[C/A]GCGCTCAGTGACTACAGCTGTGAGTATCTATAATCTATTTTTTTTAGGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34512
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109785 Nonsense 796 2284 16 38
ENSDART00000147417 Nonsense 796 1279 17 25
Genomic Location (Zv9):
Chromosome 8 (position 54182315)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51917674
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTTCAGCTCCTGCCTGGAGACGACTGAAGTGTCTCTCAATGAAGCCCTG[C/T]AGCACTTGAACTCTGCATTACCCAGCAGCCCCTCTGCTAAGGAAGAGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41306
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109785 Nonsense 947 2284 19 38
ENSDART00000147417 Nonsense 946 1279 20 25
Genomic Location (Zv9):
Chromosome 8 (position 54179006)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51914365
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTCAGATGCGCGTTCTGCGG[G/T]AGAAGCTCTCGGGACATGAGAATCTGCCTTATAAAGAGGATCTGGAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7162
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109785 Nonsense 971 2284 19 38
ENSDART00000147417 Nonsense 970 1279 20 25
Genomic Location (Zv9):
Chromosome 8 (position 54178932)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51914291
KASP Assay ID:
554-4750.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCCTTATAAAGAGGATCTGGAGATGGCACTCGAGCAGTGTTTCTTCTG[T/A]CTGTAYGCSTACCCCAGCAAGAAGAGCAAAGCCCGATATCTGGAGGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18932
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109785 Essential Splice Site 1741 2284 31 38
ENSDART00000147417   None 1279 None 25
Genomic Location (Zv9):
Chromosome 8 (position 54108898)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51844257
KASP Assay ID:
2260-1222.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATTACTCAAAATCTCCCTCATGCTTCAGAGAACCCCCGACCAGGGAAA[G/A]TAAGACCACTGACTATAATACATTTGTTCAGTGTTTGCATATTTAGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41305
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109785 Nonsense 2260 2284 38 38
ENSDART00000147417   None 1279 None 25

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 54057923)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 51793282
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCAGTCGGCAGCTAATGTGAAGAAGGACACCCTGGCTCAGCCTGCGCTA[G/T]AAGTGCAGGAGACGTCCAGTCAGGAGTCGTCCCTGGAGAGTGAATCAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link