LOC559809

Ensembl ID:
ENSDARG00000079324
Human Orthologue:
ANO9
Human Description:
anoctamin 9 [Source:HGNC Symbol;Acc:20679]
Mouse Orthologue:
Ano9
Mouse Description:
anoctamin 9 Gene [Source:MGI Symbol;Acc:MGI:1918595]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20985 Nonsense Available for shipment Available now
sa34107 Essential Splice Site Mutation detected in F1 DNA During 2016
sa38622 Essential Splice Site Mutation detected in F1 DNA During 2016
sa17446 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20985
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115420 Nonsense 103 788 4 24
Genomic Location:
Chromosome 7 (position 34240885)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGAGATTTTTACAAAGTACAAGTACCTGCTGAAGGTGTCCGATGGCTG[T/A]AACTGGAGTGCAGAGGAAAGCCGTGAATCATCTGTCTCCTTCTGCACCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34107
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115420 Essential Splice Site 185 788 7 24
Genomic Location:
Chromosome 7 (position 34243410)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGTATTCAGTTTTGAGGCTTTTTCAACAGCCTGTTACTGATGTAAAG[T/C]AAGTTCTCCCTGGTTTTATTTTGTTATATCTTTTTTTGCTTATTTATTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38622
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115420 Essential Splice Site 282 788 10 24
Genomic Location:
Chromosome 7 (position 34247747)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGACAATGAAGGCACCGTGGCTTTTGCGATGTTCATGGCAATTTGGGG[T/G]GAGTTTTTCCACTTGAACTTAAGCAAAACTGTTTCTTGTGTGATAAATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17446
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115420 Essential Splice Site 567 788 18 24
Genomic Location:
Chromosome 7 (position 34252203)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAGTGATGTCAATGCTTTCTCCTTGTTTAATGAGTTTTTGGAAATGGG[T/C]ATGTATMTCCTTTGTCATTACATAGTGCATCTTCATRGTGCTAAYTTTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link