DLC1

Ensembl ID:
ENSDARG00000079317
Description:
deleted in liver cancer 1 [Source:HGNC Symbol;Acc:2897]
Human Orthologue:
DLC1
Human Description:
deleted in liver cancer 1 [Source:HGNC Symbol;Acc:2897]
Mouse Orthologue:
Dlc1
Mouse Description:
deleted in liver cancer 1 Gene [Source:MGI Symbol;Acc:MGI:1354949]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1141 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1141
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109970 Nonsense 1125 1128 14 14
Genomic Location (Zv9):
Chromosome 1 (position 14020244)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 14607030
KASP Assay ID:
554-1052.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCACCTATGTGCTGCGGAGGTGGTGCGGATACGAGACACTTTTACCTG[T/A]CTGGACAAATAAACACACACATCTATGTTGGCGTTTCATTTCATCTCTTA
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Schizophrenia: Genome-wide association study in a Swedish population yields support for greater CNV and MHC involvement in schizophrenia compared with bipolar disorder. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link