PELP1

Ensembl ID:
ENSDARG00000079313
Description:
proline, glutamate and leucine rich protein 1 [Source:HGNC Symbol;Acc:30134]
Human Orthologue:
PELP1
Human Description:
proline, glutamate and leucine rich protein 1 [Source:HGNC Symbol;Acc:30134]
Mouse Orthologue:
Pelp1
Mouse Description:
proline, glutamic acid and leucine rich protein 1 Gene [Source:MGI Symbol;Acc:MGI:1922523]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31571 Essential Splice Site Available for shipment Available now
sa20939 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31571
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112908 Essential Splice Site 220 1038 7 22
Genomic Location (Zv9):
Chromosome 7 (position 27137147)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 25740086
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCATCAGCCAATAGCATACTGGGACAGCTTTATCATGGTGCAGAAACGG[G/T]TATGTAAGTGTTTTGAATGCATGTTTTTGTTTGCGTTTATACATTTCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20939
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112908 Nonsense 722 1038 16 22
Genomic Location (Zv9):
Chromosome 7 (position 27146433)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 25749372
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATGCCAGCTGGTATGATGATGGAGATGCAAGATGGAGCAGCAAATACA[C/T]AATCGTTGTCTCAACCAGCAGTTTCAACAGTAGGAGGTCTGCAGACCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link