mll3a

Ensembl ID:
ENSDARG00000079312
ZFIN ID:
ZDB-GENE-080520-3
Description:
Myeloid/lymphoid or mixed-lineage leukemia 3a [Source:UniProtKB/TrEMBL;Acc:A5XBQ5]
Human Orthologue:
MLL3
Human Description:
myeloid/lymphoid or mixed-lineage leukemia 3 [Source:HGNC Symbol;Acc:13726]
Mouse Orthologue:
Mll3
Mouse Description:
myeloid/lymphoid or mixed-lineage leukemia 3 Gene [Source:MGI Symbol;Acc:MGI:2444959]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5072 Nonsense Mutation detected in F1 DNA During 2016
sa5073 Nonsense Mutation detected in F1 DNA During 2016
sa44086 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa5072
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115053   None 44 None 2
ENSDART00000137010 Nonsense 385 1178 8 18
Genomic Location:
Chromosome 24 (position 7643229)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGTGTCAGCACTAGCAAACATGCTTTGTGTRTCCATACCGGGGAACTA[T/A]GAGGTGACTCGCTCTCCAGGACCAGAGCACCGCAGCTCAATAGACATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115053   None 44 None 2
ENSDART00000137010 Nonsense 456 1178 9 18
Genomic Location:
Chromosome 24 (position 7645233)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGACGAGACTACGGTCAGATGCATGGMAGCAGTCTAGGATCCAAACCA[C/T]AATGGTGCTCCCATTGTAGGGTGGTGGTCCTTGGAAATGGGGTTCGGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44086
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115053   None 44 None 2
ENSDART00000137010 Nonsense 960 1178 13 18
Genomic Location:
Chromosome 24 (position 7653135)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGCTTCCTGGAGTGGAGGCATGCGAGCGGTACACGTTTCGTTATGGA[C/T]GAAACCCGCTGATGCAGCTCCCTTTGGCCATCAACCCCTCTGGATGTGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link