mll3a

Ensembl ID:
ENSDARG00000079312
ZFIN ID:
ZDB-GENE-080520-3
Description:
Myeloid/lymphoid or mixed-lineage leukemia 3a [Source:UniProtKB/TrEMBL;Acc:A5XBQ5]
Human Orthologue:
MLL3
Human Description:
myeloid/lymphoid or mixed-lineage leukemia 3 [Source:HGNC Symbol;Acc:13726]
Mouse Orthologue:
Mll3
Mouse Description:
myeloid/lymphoid or mixed-lineage leukemia 3 Gene [Source:MGI Symbol;Acc:MGI:2444959]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5072 Nonsense Mutation detected in F1 DNA During 2014
sa5073 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa5072
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115053 None None 44 None 2
ENSDART00000137010 Nonsense 385 1178 8 18
Genomic Location:
Chromosome 24 (position 7643229)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGTGTCAGCACTAGCAAACATGCTTTGTGTRTCCATACCGGGGAACTA[T/A]GAGGTGACTCGCTCTCCAGGACCAGAGCACCGCAGCTCAATAGACATGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5073
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115053 None None 44 None 2
ENSDART00000137010 Nonsense 456 1178 9 18
Genomic Location:
Chromosome 24 (position 7645233)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGACGAGACTACGGTCAGATGCATGGMAGCAGTCTAGGATCCAAACCA[C/T]AATGGTGCTCCCATTGTAGGGTGGTGGTCCTTGGAAATGGGGTTCGGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/61t78ds0