mll3a

Ensembl ID:
ENSDARG00000079312
ZFIN ID:
ZDB-GENE-080520-3
Description:
Myeloid/lymphoid or mixed-lineage leukemia 3a [Source:UniProtKB/TrEMBL;Acc:A5XBQ5]
Human Orthologue:
MLL3
Human Description:
myeloid/lymphoid or mixed-lineage leukemia 3 [Source:HGNC Symbol;Acc:13726]
Mouse Orthologue:
Mll3
Mouse Description:
myeloid/lymphoid or mixed-lineage leukemia 3 Gene [Source:MGI Symbol;Acc:MGI:2444959]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44086 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa44086
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115053   None 44 None 2
ENSDART00000137010 Nonsense 960 1178 13 18
Genomic Location (Zv9):
Chromosome 24 (position 7653135)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 7510427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAGCTTCCTGGAGTGGAGGCATGCGAGCGGTACACGTTTCGTTATGGA[C/T]GAAACCCGCTGATGCAGCTCCCTTTGGCCATCAACCCCTCTGGATGTGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link