si:ch211-198n5.8

Ensembl ID:
ENSDARG00000079308
ZFIN ID:
ZDB-GENE-081104-165
Description:
torsin-3A [Source:RefSeq peptide;Acc:NP_001121738]
Human Orthologue:
TOR3A
Human Description:
torsin family 3, member A [Source:HGNC Symbol;Acc:11997]
Mouse Orthologue:
Tor3a
Mouse Description:
torsin family 3, member A Gene [Source:MGI Symbol;Acc:MGI:1353652]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21235 Nonsense Available for shipment Available now
sa41161 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21235
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102556 Nonsense 54 367 1 6
Genomic Location (Zv9):
Chromosome 8 (position 17128138)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16573026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTGCAATATTTGGGAAGGAGACTGTCAACCACATCAGGATGACGCGACT[C/T]AACAAGGTAAATATAAGTAAGATGGATACTGACAGATGGTGATTTCATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41161
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102556 Nonsense 290 367 6 6
Genomic Location (Zv9):
Chromosome 8 (position 17117592)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16562480
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTGATATTCCTCACTAAGCATCTGTTCACCTTTGCAGGAGGTTTTGCA[C/T]AGAGCGAGCTGATGTCAGGCCATCTGATTGACTTCTTTGTACCGTTCTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link