RLIM

Ensembl ID:
ENSDARG00000079306
Description:
ring finger protein, LIM domain interacting [Source:HGNC Symbol;Acc:13429]
Human Orthologue:
RLIM
Human Description:
ring finger protein, LIM domain interacting [Source:HGNC Symbol;Acc:13429]
Mouse Orthologue:
Rlim
Mouse Description:
ring finger protein, LIM domain interacting Gene [Source:MGI Symbol;Acc:MGI:1342291]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16516 Nonsense Available for shipment Available now
sa4550 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa16516
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113567 Nonsense 116 596 3 4
Genomic Location:
Chromosome 14 (position 11498187)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAAAACCCAAGTGGGGAGACCCTTCTTGACTGGCTGAACACAGTACGA[C/T]AGACRGGGAATACAACTAGGAGTGGTTACCGGGGTAACCAGTCATGGCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4550
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113567 Nonsense 269 596 4 4
Genomic Location:
Chromosome 14 (position 11498772)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCACAGGTTGAGGGAAGCTCAAGGACTCGGCAACTGTTTTTATCTAGG[C/T]AGAGCACAGTRGAAACGGAAACTCATACTTTGGGAKCAGCAACTGACGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7swqtkiz