and2

Ensembl ID:
ENSDARG00000079302
ZFIN ID:
ZDB-GENE-041105-2
Description:
actinodin2 [Source:RefSeq peptide;Acc:NP_001104660]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6850 Nonsense Mutation detected in F1 DNA During 2014
sa19793 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6850
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114928 Nonsense 214 508 5 5
Genomic Location:
Chromosome 2 (position 31481320)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCCAGTCATGGARCCATTTTTGTCAGCTGAGCAGAGAGCAGAGCTGT[T/A]GCGCATCTGCAACCCTTCAGACACAGAGTGTCTGCAATATCAYTTGCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19793
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114928 Nonsense 271 508 5 5
Genomic Location:
Chromosome 2 (position 31481148)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCCTTACTGTCAGCCCAAGCTTGTGGCAAGATCTCCCTCAGGTTTGTA[T/A]CACCTGTACCCTTCCTGTAATCCCGCCACTGACCCTCTTTGTGTTGCCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/f6xmmnma