and2

Ensembl ID:
ENSDARG00000079302
ZFIN ID:
ZDB-GENE-041105-2
Description:
actinodin2 [Source:RefSeq peptide;Acc:NP_001104660]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39857 Nonsense Mutation detected in F1 DNA During 2016
sa6850 Nonsense Mutation detected in F1 DNA During 2016
sa39856 Nonsense Mutation detected in F1 DNA During 2016
sa19793 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39857
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114928 Nonsense 195 508 5 5
Genomic Location (Zv9):
Chromosome 2 (position 31481376)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31781313
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCTGTCACCTCTGCTCCCGCTGCCCCTGAAAGCACCTCTAGCCCATTA[T/G]TACTATGCTCCAGTCATGGAGCCATTTTTGTCAGCTGAGCAGAGAGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6850
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114928 Nonsense 214 508 5 5
Genomic Location (Zv9):
Chromosome 2 (position 31481320)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31781257
KASP Assay ID:
554-4779.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCTCCAGTCATGGARCCATTTTTGTCAGCTGAGCAGAGAGCAGAGCTGT[T/A]GCGCATCTGCAACCCTTCAGACACAGAGTGTCTGCAATATCAYTTGCGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39856
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114928 Nonsense 230 508 5 5
Genomic Location (Zv9):
Chromosome 2 (position 31481273)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31781210
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGCGCATCTGCAACCCTTCAGACACAGAGTGTCTGCAATATCACTTG[C/T]GAGCTGCTTACGGCTACAGACCCGCACTCGGCCCTCTGCCTTCTTACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19793
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114928 Nonsense 271 508 5 5
Genomic Location (Zv9):
Chromosome 2 (position 31481148)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 31781085
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCCTTACTGTCAGCCCAAGCTTGTGGCAAGATCTCCCTCAGGTTTGTA[T/A]CACCTGTACCCTTCCTGTAATCCCGCCACTGACCCTCTTTGTGTTGCCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link