cacna1bb

Ensembl ID:
ENSDARG00000079295
ZFIN ID:
ZDB-GENE-090514-4
Mouse Orthologue:
Cacna1b
Mouse Description:
calcium channel, voltage-dependent, N type, alpha 1B subunit Gene [Source:MGI Symbol;Acc:MGI:88296]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3120 Nonsense F2 line generated During 2016
sa3131 Essential Splice Site F2 line generated During 2016
sa37258 Splice Site Mutation detected in F1 DNA During 2016
sa32339 Nonsense Mutation detected in F1 DNA During 2016
sa29548 Nonsense Mutation detected in F1 DNA During 2016
sa32338 Essential Splice Site Mutation detected in F1 DNA During 2016
sa43605 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa3120
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089967 Nonsense 26 2333 1 52
ENSDART00000132142 Nonsense 26 1151 1 23
Genomic Location (Zv9):
Chromosome 21 (position 12832853)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14534027
KASP Assay ID:
554-2930.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACCCGCTATGGAGGTCCAGCGGGCGCCGGGAGAGGGGGAGCCCGGGCG[G/T]GAGGTCCCTCGGGCGGTCAAAGAATGTACAAACAGTCGATGGCTCAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3131
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089967 Essential Splice Site 384 2333 8 52
ENSDART00000132142 Essential Splice Site 383 1151 8 23
Genomic Location (Zv9):
Chromosome 21 (position 12704643)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14405817
KASP Assay ID:
554-3323.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGATTGAGAGGGAGCTCACCGGCTACTTGGAATGGATCTGCAAAGCAG[G/A]TTAGTGTAAAAGTGACATTTCTCTGGTGTACAGTTAGAATCAGCTTTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37258
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089967 Splice Site None 2333 None 52
ENSDART00000132142   None 1151 None 23

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12638323)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14339497
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGCCTTTCTGACCCTCTTCACTGTGTCTACAGGAGAGGGCTGGCCACT[G/T]TAAGTTCACTTCATCTATCACACACACACACACACACACACACACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32339
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089967 Nonsense 1487 2333 32 52
ENSDART00000132142   None 1151 None 23
Genomic Location (Zv9):
Chromosome 21 (position 12631375)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14332549
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCACTGTGTGTTTGTGCTTTCTGCAGTTCCATGGTGCTCCTAAACCTTA[T/A]GAGGACATGTTGAAGTGGCTGAACATCATCTTCACTGCACTCTTCACACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29548
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089967 Nonsense 1720 2333 39 52
ENSDART00000132142   None 1151 None 23
Genomic Location (Zv9):
Chromosome 21 (position 12615851)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14317025
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAATATCTGACACGAGATGCTTCTATTCTGGGGCCTCATCACCTAGAT[G/T]AGTTCATCCGCGTCTGGGCTGAGTACGACCCTGCCGCCTGGTGCGTATCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32338
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089967 Essential Splice Site 1837 2333 42 52
ENSDART00000132142   None 1151 None 23
Genomic Location (Zv9):
Chromosome 21 (position 12603502)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14304676
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAGTTTGTCATCTAAAACAGTAGACCTGCTGGTTACACCTCATAAACG[T/C]AAGCTGTGCATAACATAATGGCAGTTTCAGTTTAAAAAGCAATTAGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43605
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089967 Nonsense 2127 2333 51 52
ENSDART00000132142   None 1151 None 23
Genomic Location (Zv9):
Chromosome 21 (position 12585785)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14286959
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCAGAAAGGAAGCAGCGATACTACTCTTGTGACCGCTACGGCAGCCAT[G/T]AACATGGCCACAGCCTGTCCGCCGGGCCTAGCCGATCCACCTCTCCTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link