cacna1bb

Ensembl ID:
ENSDARG00000079295
ZFIN ID:
ZDB-GENE-090514-4
Mouse Orthologue:
Cacna1b
Mouse Description:
calcium channel, voltage-dependent, N type, alpha 1B subunit Gene [Source:MGI Symbol;Acc:MGI:88296]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3120 Nonsense F2 line generated During 2014
sa3131 Essential Splice Site F2 line generated During 2014
sa7952 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3120
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089967 Nonsense 26 2333 1 52
ENSDART00000132142 Nonsense 26 1151 1 23
Genomic Location:
Chromosome 21 (position 12832853)
KASP Assay ID:
554-2930.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACCCGCTATGGAGGTCCAGCGGGCGCCGGGAGAGGGGGAGCCCGGGCG[G/T]GAGGTCCCTCGGGCGGTCAAAGAATGTACAAACAGTCGATGGCTCAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3131
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089967 Essential Splice Site 384 2333 8 52
ENSDART00000132142 Essential Splice Site 383 1151 8 23
Genomic Location:
Chromosome 21 (position 12704643)
KASP Assay ID:
554-3323.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCAGATTGAGAGGGAGCTCACCGGCTACTTGGAATGGATCTGCAAAGCAG[G/A]TTAGTGTAAAAGTGACATTTCTCTGGTGTACAGTTAGAATCAGCTTTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7952
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089967 Essential Splice Site 998 2333 20 52
ENSDART00000132142 Essential Splice Site 1000 1151 20 23
Genomic Location:
Chromosome 21 (position 12671041)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGTCCACATTGGAYGGAGACGAATGTAGAGAGAATGGTGGTAAACGCAG[G/A]TAGGTTTTTATAGTGTACAGTGGCACCCAGAAAGTATTTKAATGCTCATT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/u8g69v4l