LOC100334474

Ensembl ID:
ENSDARG00000079292
Human Orthologues:
SAMD9, SAMD9L
Human Descriptions:
sterile alpha motif domain containing 9 [Source:HGNC Symbol;Acc:1348]
sterile alpha motif domain containing 9-like [Source:HGNC Symbol;Acc:1349]
Mouse Orthologue:
Samd9l
Mouse Description:
sterile alpha motif domain containing 9-like Gene [Source:MGI Symbol;Acc:MGI:1343184]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6877 Nonsense Mutation detected in F1 DNA During 2016
sa33084 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6877
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108630 Nonsense 438 954 1 3
Genomic Location (Zv9):
Chromosome 3 (position 6850978)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6674672
KASP Assay ID:
554-4830.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAACATTCTGCTTACAACWGAKTTATTTTAYGAGTACACTCTGGGAAAA[C/T]AAAAATTAATGCAGGATGTTCACARCATGTTGGTGAGGAGGCAGAATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33084
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108630 Nonsense 634 954 1 3
Genomic Location (Zv9):
Chromosome 3 (position 6851566)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 6674084
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACACCACCGTATAAATCACAGTCAGAGCTAGCGGGATCAAACACAAAA[C/T]AGTCGACTGATGCAGAGAGTGAGCCATATTACCAAGTACTGGGGAGGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link