rapgef3

Ensembl ID:
ENSDARG00000079291
ZFIN ID:
ZDB-GENE-090312-38
Human Orthologue:
RAPGEF3
Human Description:
Rap guanine nucleotide exchange factor (GEF) 3 [Source:HGNC Symbol;Acc:16629]
Mouse Orthologue:
Rapgef3
Mouse Description:
Rap guanine nucleotide exchange factor (GEF) 3 Gene [Source:MGI Symbol;Acc:MGI:2441741]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44024 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa44024
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114423 Essential Splice Site 736 885 22 28
ENSDART00000142328 Essential Splice Site 675 824 19 25

The following transcripts of ENSDARG00000079291 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 33650351)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 33510149
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTTGGCCTCAGCAACAGTGCAGTGCAGAGGCTCAATAAAACATGGGAG[G/A]TAAGGACGAATGCGCTTTCTTAGGCTATATAATAATCTGCCTTTAATAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link