ENSDARG00000079289

Ensembl ID:
ENSDARG00000079289
Human Orthologue:
PPP4R1L
Human Description:
protein phosphatase 4, regulatory subunit 1-like [Source:HGNC Symbol;Acc:15755]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16511 Essential Splice Site Available for shipment Available now
sa5386 Nonsense Mutation detected in F1 DNA During 2014
sa15442 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16511
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109237 Essential Splice Site 97 923 4 26
Genomic Location:
Chromosome 6 (position 49495456)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTTCATCAGTGTCAYGGAAACGGTTGCCAGGATGTCTGAGGATGGAGG[T/G]TTGTATGGCTTTAGMCTTTATTTGACTTGATTCCGTATGGTGGAACTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5386
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109237 Nonsense 795 923 24 26
Genomic Location:
Chromosome 6 (position 49479508)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGTGAATGTTTGTCAGGTGGTGGAGATCCTGCAGAAGTTGTATTCCTG[T/A]GAAGCTCATGACTTGGGACTYAATTTCATTAATGAGCTCATTATGAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15442
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109237 Essential Splice Site 829 923 24 26
Genomic Location:
Chromosome 6 (position 49479404)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACAGTCCCAAATGGGTCGGGCGTCAGGCATTTGCTTTCATTTGCCAGG[T/C]ATGATGTTWGACTTCWAGAATCATTCAAAGGATTTACAGGGNTTTCTTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kb5xape6