bcr

Ensembl ID:
ENSDARG00000079286
ZFIN ID:
ZDB-GENE-040724-43
Description:
Novel protein similar to human breakpoint cluster region (BCR) [Source:UniProtKB/TrEMBL;Acc:Q6ZM59]
Human Orthologue:
BCR
Human Description:
breakpoint cluster region [Source:HGNC Symbol;Acc:1014]
Mouse Orthologue:
Bcr
Mouse Description:
breakpoint cluster region Gene [Source:MGI Symbol;Acc:MGI:88141]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13597 Nonsense Available for shipment Available now
sa12702 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13597
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101282 Nonsense 715 1341 7 23
Genomic Location:
Chromosome 21 (position 15701033)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTANNNNNNNNNNTGTGTGTGTGNNNNTGTTCTCTTYTGTCTTGTCTCTGCCAGCTCTGCTCTA[T/A]AAACCAGTGGACAGAGTGACCCGGAGCACGCTTGTTTTGCATGTGAGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12702
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000101282 Nonsense 1042 1341 16 23
Genomic Location:
Chromosome 21 (position 15758340)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AWTGTTTCTGCYTCAGGAGTTTGAGATTGAGTTGGAAGGCTCTCATACAT[T/A]RCGGCTACTTTGTTACGAGAAAAGCTACAACAAAGCCAAGGTGAATAAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xn4gt3z5