dhrsx

Ensembl ID:
ENSDARG00000079280
ZFIN ID:
ZDB-GENE-060620-2
Description:
Novel protein similar to H.sapiens DHRSX, dehydrogenase/reductase (SDR family) X-linked (DHRSX) [Sou
Human Orthologue:
DHRSX
Human Description:
dehydrogenase/reductase (SDR family) X-linked [Source:HGNC Symbol;Acc:18399]
Mouse Orthologue:
Dhrsx
Mouse Description:
dehydrogenase/reductase (SDR family) X chromosome Gene [Source:MGI Symbol;Acc:MGI:2181510]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32707 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32707
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110026 Nonsense 59 324 2 8
ENSDART00000133870 Nonsense 59 93 2 3
ENSDART00000139004 Nonsense 7 41 2 3
Genomic Location (Zv9):
Chromosome 1 (position 33069309)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 32671489
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTTGCCATAGTTACAGGGGGAACCAGAGGAATGGGATATGAGATTTCC[A/T]GACATCTGGTCAGCCTGGACATGCATGTGATCATTGGTATAGTATCACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link