EGR4 (2 of 2)

Ensembl ID:
ENSDARG00000079277
Description:
early growth response 4 [Source:HGNC Symbol;Acc:3241]
Human Orthologue:
EGR4
Human Description:
early growth response 4 [Source:HGNC Symbol;Acc:3241]
Mouse Orthologue:
Egr4
Mouse Description:
early growth response 4 Gene [Source:MGI Symbol;Acc:MGI:99252]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32729 Nonsense Mutation detected in F1 DNA During 2016
sa19546 Nonsense Available for shipment Available now
sa19547 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa32729
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109638 Nonsense 77 330 3 5
Genomic Location:
Chromosome 1 (position 42013027)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTCACCGGGACAGACAGGCCACAGCTACCCGGACACTCAGACCGCCACG[C/T]AGGCCCAAGACTCCGCCACATCGCATTTAAACTTTGCCTCCTCTGCGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19546
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109638 Nonsense 146 330 4 5
Genomic Location:
Chromosome 1 (position 42013262)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCGAATAGCTTTTCAGCTGATCAACAACAGGTGGACGTGAAGGAACTTT[T/A]AGACTCATATTCTCCCATTTGCTCGAACACAGAGACTGAATTCAAAGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19547
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109638 Nonsense 263 330 5 5
Genomic Location:
Chromosome 1 (position 42013725)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCACATCCGCATCCACACGGGACACAAACCTTTCCAGTGCCGCATCTG[T/A]TTGCGCAGCTTCAGCAGAAGCGACCATCTGACCACACACACCCGCACTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link