si:ch211-223p9.3

Ensembl ID:
ENSDARG00000079267
ZFIN IDs:
ZDB-GENE-080917-11, ZDB-GENE-081031-46
Description:
Novel protein similar to vertebrate UNC-112 related protein 2 (URP2) [Source:UniProtKB/TrEMBL;Acc:B8
Human Orthologue:
FERMT3
Human Description:
fermitin family member 3 [Source:HGNC Symbol;Acc:23151]
Mouse Orthologue:
Fermt3
Mouse Description:
fermitin family homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2147790]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40594 Nonsense Mutation detected in F1 DNA During 2017
sa31489 Essential Splice Site Available for shipment Available now
sa31488 Essential Splice Site Available for shipment Available now
sa33766 Nonsense Mutation detected in F1 DNA During 2017
sa11472 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa40594
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113077 Nonsense 40 641 1 14
ENSDART00000141095   None 349 None 8
Genomic Location (Zv9):
Chromosome 5 (position 69792467)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66119508
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTCACTTCAGATTTACACATCGGCGGAGTCATCCTCAAAGTTGTGGAA[A/T]AGTCACGTGAGTTTCTAGTGGCTGATTTGAAGAGGCTGTTAATCATACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31489
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113077 Essential Splice Site 285 641 6 14
ENSDART00000141095 Essential Splice Site 36 349 1 8
Genomic Location (Zv9):
Chromosome 5 (position 69763725)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66088908
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAAATCGAATGCACTGAGGAGGAGATGATGGTCTTTGCTGCATTACAG[G/A]TACAGATGATGGACAGCAGATATCAGCTCATTATATGAATGATAGTTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31488
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113077 Essential Splice Site 421 641 10 14
ENSDART00000141095 Essential Splice Site 129 349 4 8
Genomic Location (Zv9):
Chromosome 5 (position 69757723)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66082906
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATACCCGGGCCAGAGGGCATGAATGAGGTCTACTTGCGCTGCGAGCATG[T/A]AAGTCAGTTATGTGTAATCTTATGAAGTGCTAATCTTTCAAACTTTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33766
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113077 Nonsense 482 641 11 14
ENSDART00000141095 Nonsense 190 349 5 8
Genomic Location (Zv9):
Chromosome 5 (position 69756394)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66081577
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATAACACAGCCCAGACGGATGAAAGCATCAACACACACAGCCTCGTCT[C/A]GCCACGCTACCAGAAGAAGTACAAACCCAAACAGGTACCACATATTAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11472
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113077 Nonsense 531 641 12 14
ENSDART00000141095 Nonsense 239 349 6 8
Genomic Location (Zv9):
Chromosome 5 (position 69754476)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66079659
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAAGTTTCTTCAGATCTGGCAGGCTCTTCCTGACTTYGGCCTCTCTTA[T/A]ATTGYAGTCAGGTAAGTTTTGTAAAAGTTGTCAGGGTTGTCATGCAAAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link