Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
foxe1
- Ensembl ID:
- ENSDARG00000079266
- ZFIN ID:
- ZDB-GENE-061116-1
- Human Orthologues:
- FOXE1, FOXE3
- Human Descriptions:
- forkhead box E1 (thyroid transcription factor 2) [Source:HGNC Symbol;Acc:3806]
- forkhead box E3 [Source:HGNC Symbol;Acc:3808]
- Mouse Orthologues:
- Foxe1, Foxe3
- Mouse Descriptions:
- forkhead box E1 Gene [Source:MGI Symbol;Acc:MGI:1353500]
- forkhead box E3 Gene [Source:MGI Symbol;Acc:MGI:1353569]
Alleles
There are 2 alleles of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa39620 | Nonsense | Mutation detected in F1 DNA | During 2018 |
| sa32687 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa39620
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000109297 | Nonsense | 33 | 354 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 1 (position 25668903)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 26009120 GRCz11 1 26702834 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCCAGTGAATGACAGTCAGAGAGCAGAGCCGCAAAGAGGCCGTCGGAGG[A/T]AGAGGCCCCTTCAGCGAGGCAAACCACCATACAGCTACATCGCTCTGATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32687
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000109297 | Nonsense | 84 | 354 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 1 (position 25668749)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 26008966 GRCz11 1 26702680 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAAGTTTATCACCGAGAGGTTTCCCTTCTATCGAGACAACTCCAAGAAAT[G/A]GCAGAACTCCATCCGCCATAATTTGACACTCAACGACTGCTTTATCAAGA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Hypothyroidism: Novel associations for hypothyroidism include known autoimmune risk loci. (View Study)
- Hypothyroidism: Variants near FOXE1 are associated with hypothyroidism and other thyroid conditions: using electronic medical records for genome- and phenome-wide studies. (View Study)
- Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
- Thyroid cancer: Common variants on 9q22.33 and 14q13.3 predispose to thyroid cancer in European populations. (View Study)
- Thyroid hormone levels: A meta-analysis of thyroid-related traits reveals novel loci and gender-specific differences in the regulation of thyroid function. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
