foxe1

Ensembl ID:
ENSDARG00000079266
ZFIN ID:
ZDB-GENE-061116-1
Human Orthologues:
FOXE1, FOXE3
Human Descriptions:
forkhead box E1 (thyroid transcription factor 2) [Source:HGNC Symbol;Acc:3806]
forkhead box E3 [Source:HGNC Symbol;Acc:3808]
Mouse Orthologues:
Foxe1, Foxe3
Mouse Descriptions:
forkhead box E1 Gene [Source:MGI Symbol;Acc:MGI:1353500]
forkhead box E3 Gene [Source:MGI Symbol;Acc:MGI:1353569]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39620 Nonsense Mutation detected in F1 DNA During 2017
sa32687 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39620
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109297 Nonsense 33 354 1 1
Genomic Location (Zv9):
Chromosome 1 (position 25668903)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 26009120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCAGTGAATGACAGTCAGAGAGCAGAGCCGCAAAGAGGCCGTCGGAGG[A/T]AGAGGCCCCTTCAGCGAGGCAAACCACCATACAGCTACATCGCTCTGATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32687
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109297 Nonsense 84 354 1 1
Genomic Location (Zv9):
Chromosome 1 (position 25668749)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 26008966
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAGTTTATCACCGAGAGGTTTCCCTTCTATCGAGACAACTCCAAGAAAT[G/A]GCAGAACTCCATCCGCCATAATTTGACACTCAACGACTGCTTTATCAAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hypothyroidism: Novel associations for hypothyroidism include known autoimmune risk loci. (View Study)
  • Hypothyroidism: Variants near FOXE1 are associated with hypothyroidism and other thyroid conditions: using electronic medical records for genome- and phenome-wide studies. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Thyroid cancer: Common variants on 9q22.33 and 14q13.3 predispose to thyroid cancer in European populations. (View Study)
  • Thyroid hormone levels: A meta-analysis of thyroid-related traits reveals novel loci and gender-specific differences in the regulation of thyroid function. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link