BAIAP3

Ensembl ID:
ENSDARG00000079264
Description:
BAI1-associated protein 3 [Source:HGNC Symbol;Acc:948]
Human Orthologue:
BAIAP3
Human Description:
BAI1-associated protein 3 [Source:HGNC Symbol;Acc:948]
Mouse Orthologue:
Baiap3
Mouse Description:
BAI1-associated protein 3 Gene [Source:MGI Symbol;Acc:MGI:2685783]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20116 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa11970 Essential Splice Site Available for shipment Available now
sa18764 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20116
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111363 Splice Site, Nonsense 522 1070 18 32
Genomic Location:
Chromosome 3 (position 45550305)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTTGTGCTGTTTCTCCAGGTGGCGGATGATGTGAATGTAGCGATGGAG[C/T]GAGTATGTGGGAATCTGGAGCAGGAGAGTTCACGGCTCACCCAAACTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11970
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111363 Essential Splice Site 596 1070 20 32
Genomic Location:
Chromosome 3 (position 45550723)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATGAACGWTCCACTGAGAGGATCCGTAAAGCAGTGGAAATGGATCCGG[T/C]GAGCTTCTGAMCAAAACCAAAARCCAAGATTATACTCTCTAAAAATGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18764
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111363 Essential Splice Site 858 1070 27 32
Genomic Location:
Chromosome 3 (position 45561794)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGGAGAAGGGTTGCTCTTGGAAGACCTTAAGAGTGGAGACTATAAGG[T/G]ATTCTCAACTACGACCAATATATCTGACCAAACGAATGAGCATAGCTTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/igwxalx3