atp8b2

Ensembl ID:
ENSDARG00000079259
ZFIN ID:
ZDB-GENE-030131-2474
Human Orthologue:
ATP8B2
Human Description:
ATPase, class I, type 8B, member 2 [Source:HGNC Symbol;Acc:13534]
Mouse Orthologue:
Atp8b2
Mouse Description:
ATPase, class I, type 8B, member 2 Gene [Source:MGI Symbol;Acc:MGI:1859660]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22823 Nonsense Available for shipment Available now
sa12701 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22823
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114515 Nonsense 241 1325 9 28
ENSDART00000140475 Nonsense 222 394 8 11
Genomic Location:
Chromosome 16 (position 24425417)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGAACATGCTGCTCCGTGGCTGTGTGCTGCGCAACACTGAGAGCTGCTA[C/A]GGCCTTGTCATATTCGCTGGTCAGTGTGTGCACTTGTTTAAATGAATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12701
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114515 Nonsense 639 1325 18 28
ENSDART00000140475 None None 394 None 11
Genomic Location:
Chromosome 16 (position 24394093)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAAWTATTATAAATATAATTTAAACCATTTAATWMTTGYTATAGTTAT[T/A]GGGGGCCACGGCTATTGAAGATAAACTGCAAGAGGGGGTTCCTGAAACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a0dl995t