gemin5

Ensembl ID:
ENSDARG00000079257
ZFIN ID:
ZDB-GENE-031112-9
Human Orthologue:
GEMIN5
Human Description:
gem (nuclear organelle) associated protein 5 [Source:HGNC Symbol;Acc:20043]
Mouse Orthologue:
Gemin5
Mouse Description:
gem (nuclear organelle) associated protein 5 Gene [Source:MGI Symbol;Acc:MGI:2449311]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24000 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24000
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109211   868 1446 22 32
ENSDART00000137309 Essential Splice Site 859 1440 None 28
Genomic Location (Zv9):
Chromosome 21 (position 35742947)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 36736195
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTCCAGCAGGACTGCCTGACTCTTGCTGCTGTAAGACACTCACACGG[T/C]AAGAACAATCAGCTGGAAAACATAAACATAATATAATAGTTAGTAGTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link