plch1

Ensembl ID:
ENSDARG00000079253
ZFIN ID:
ZDB-GENE-060503-398
Description:
Novel protein similar to H.sapiens PLCH1, phospholipase C, eta 1 (PLCH1) [Source:UniProtKB/TrEMBL;Ac
Human Orthologue:
PLCH1
Human Description:
phospholipase C, eta 1 [Source:HGNC Symbol;Acc:29185]
Mouse Orthologue:
Plch1
Mouse Description:
phospholipase C, eta 1 Gene [Source:MGI Symbol;Acc:MGI:2683547]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa43139 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43139
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000079341 Nonsense 573 1082 13 23
ENSDART00000135965 Nonsense 425 846 10 19
ENSDART00000147463   None 114 None 2
Genomic Location (Zv9):
Chromosome 18 (position 32233051)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 34029910
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAAATCAAGGCTTAAATGTCAAAGTGTTGAAACAGAAGATGACAGCCAG[C/T]AAGAGCCATCAGGTGGACAGTTCAACAGGTGTGCCTCTGGATATTTAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link