nlgn2b

Ensembl ID:
ENSDARG00000079251
ZFIN ID:
ZDB-GENE-090918-3
Description:
neuroligin 2a [Source:RefSeq peptide;Acc:NP_001159808]
Human Orthologue:
NLGN2
Human Description:
neuroligin 2 [Source:HGNC Symbol;Acc:14290]
Mouse Orthologue:
Nlgn2
Mouse Description:
neuroligin 2 Gene [Source:MGI Symbol;Acc:MGI:2681835]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6171 Nonsense Mutation detected in F1 DNA During 2017
sa9514 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6171
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112484 Nonsense 132 860 1 8
Genomic Location (Zv9):
Chromosome 10 (position 22582631)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 22412969
KASP Assay ID:
554-5405.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCCCSCAGAACATCCATGGGGTGCTGCCAGAGATCATGCTTCCCGTATG[G/A]TTCACYGACAACCTGGATGCAGCCGCTGCTTAYGTACAGAACCAGAGCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9514
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112484 Nonsense 351 860 5 8
Genomic Location (Zv9):
Chromosome 10 (position 22675977)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 22506315
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGATCTGGTTGACTGTCTRCGAAGGAARAGCTACAGGGAGCTGGTGGAT[C/T]AGGATGTCCAACCTGCCCGATACCACATWGCRTTTGGACCAGTGGTGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link