LOC559207

Ensembl ID:
ENSDARG00000079249
Human Orthologues:
OGDH, OGDHL
Human Descriptions:
oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide) [Source:HGNC Symbol;Acc:8124]
oxoglutarate dehydrogenase-like [Source:HGNC Symbol;Acc:25590]
Mouse Orthologues:
Ogdh, Ogdhl
Mouse Descriptions:
oxoglutarate dehydrogenase (lipoamide) Gene [Source:MGI Symbol;Acc:MGI:1098267]
oxoglutarate dehydrogenase-like Gene [Source:MGI Symbol;Acc:MGI:3616088]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10136 Nonsense Available for shipment Available now
sa18242 Essential Splice Site Available for shipment Available now
sa12904 Nonsense Available for shipment Available now
sa2685 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa10136
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113009 Nonsense 378 1008 8 22
Genomic Location:
Chromosome 13 (position 29596588)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCACCTTGAGGCTGTAGATCCTGTCRTTCAGGGCAAGACCAAAGCAGAG[C/T]AGTTTTACAGAGGAGAYACTGAAGGAAGRAGGGTGAAACANNNATTTTCAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18242
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113009 Essential Splice Site 491 1008 10 22
Genomic Location:
Chromosome 13 (position 29598142)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGCAGAGTGGAGAACCAYTTTCAACAAGGATGTGGTGATTGACCTGG[T/C]AAATKCTGTGAAGACACAGCCTACATATCACAAAAAAATTTAATTGAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12904
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113009 Nonsense 795 1008 17 22
Genomic Location:
Chromosome 13 (position 29621406)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACGGCCTGAACGCTTCCTGCAGATGAGCAAAGATGACCCCGATCGCTA[T/A]CCGGTGAGTGGTCCTTCCTGCAATGCCTCATGCTGATGGCCACAGGTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2685
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113009 Nonsense 903 1008 20 22
Genomic Location:
Chromosome 13 (position 29626004)
KASP Assay ID:
554-2608.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATCTTCWGCACTGGAAAGGTGTACTATGAGCTAGCCAAAGAAAGAAAA[C/T]AGCTGAAGTTGGAAGAGAATGTTGCAATAGTCCGACTGGAGCAGGTCGCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/a3284nqo