si:ch211-223p9.1

Ensembl ID:
ENSDARG00000079248
ZFIN ID:
ZDB-GENE-080917-23
Description:
Novel protein similar to human meningioma (Disrupted in balanced translocation) 1 (MN1) [Source:UniP
Human Orthologue:
MN1
Human Description:
meningioma (disrupted in balanced translocation) 1 [Source:HGNC Symbol;Acc:7180]
Mouse Orthologue:
Mn1
Mouse Description:
meningioma 1 Gene [Source:MGI Symbol;Acc:MGI:1261813]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33765 Nonsense Mutation detected in F1 DNA During 2017
sa26622 Nonsense Mutation detected in F1 DNA During 2017
sa33764 Nonsense Available for shipment Available now
sa33763 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33765
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109566 Nonsense 284 1204 1 3
ENSDART00000129197 Nonsense 284 1211 1 2
Genomic Location (Zv9):
Chromosome 5 (position 69697341)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66022524
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGACAGGGCGCCAGGTACCAGGGTCCAATTTTCCTGGAAACACAGGGT[T/A]GTCTCGCGCTCCTGGAATGCAGGGCATCGCTAAAGAGCACCCCCATGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa26622
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109566 Nonsense 524 1204 1 3
ENSDART00000129197 Nonsense 524 1211 1 2
Genomic Location (Zv9):
Chromosome 5 (position 69696622)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66021805
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGATGGCGTCTCGGAGCCAGCAGCAGAGGATGAGACAACCCAGTCTA[C/T]AGCAGCTGGGTCACCACAATGATGTTTCTCAAGGGCCCCTGGGACCAGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33764
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109566 Nonsense 607 1204 1 3
ENSDART00000129197 Nonsense 607 1211 1 2
Genomic Location (Zv9):
Chromosome 5 (position 69696373)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66021556
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTTCAAGTGGTGAGATGGGGGATCGAGACATCCAGCAAAATGGTCCT[G/T]GAATGATGTTCAGAGCTGGTGTGAGTGGAATGGGCATGCAGGAGTCTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33763
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109566 Essential Splice Site 1152 1204 2 3
ENSDART00000129197   None 1211 None 2
Genomic Location (Zv9):
Chromosome 5 (position 69691185)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 66016368
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCATGTTCAAGAAACCAGTCGGCACATTCTGACCCTAGCATCCTGATG[T/C]CGGCAGCCCAGGCTCATTCTGAAAACGTAGTCCAGCGGATGTTTCTGGAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link