A1A5T0_DANRE

Ensembl ID:
ENSDARG00000079235
Description:
LOC563450 protein [Source:UniProtKB/TrEMBL;Acc:A1A5T0]
Mouse Orthologue:
Atp8b5
Mouse Description:
ATPase, class I, type 8B, member 5 Gene [Source:MGI Symbol;Acc:MGI:2444287]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41624 Nonsense Mutation detected in F1 DNA During 2016
sa12605 Nonsense Available for shipment Available now
sa13002 Nonsense Available for shipment Available now
sa12987 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41624
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109548 Nonsense 595 1189 17 27
Genomic Location (Zv9):
Chromosome 10 (position 17103597)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17089489
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTTTTTCTGTCAATTACACACGTTTGCCTCTCTCAATCCCAGGAATA[T/A]GCTGGAGAGGGTCTGAGGACTTTGGCTCTGGCCTATAAAGACTTGGATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12605
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109548 Nonsense 773 1189 21 27
Genomic Location (Zv9):
Chromosome 10 (position 17100397)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17092689
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGCTGATTTGAAGAACATGTCGTTTTTTGTGCCCAGGCRTTCGCTCTG[C/T]AGAAGGAYATGCAGGTGGAGCTGTTGCGGACRGCRTGTATGTGCCAAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13002
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109548 Nonsense 1160 1189 27 27
ENSDART00000109548 Nonsense 1160 1189 27 27
Genomic Location (Zv9):
Chromosome 10 (position 17088596)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17104490
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGAGACCTGRTCACCTCWGGACGCTTCCTGCGGATCCCRGTTAAAAGT[A/T]GACCAKCTCTTTTCTCTAAAAATGAGTCTCCGGTGGCTGACAGCACACCW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12987
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109548 Nonsense 1160 1189 27 27
ENSDART00000109548 Nonsense 1160 1189 27 27
Genomic Location (Zv9):
Chromosome 10 (position 17088596)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17104490
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGGAGACCTGRTCACCTCWGGACGCTTCCTGCGGATCCCRGTTAAAAGT[A/T]GACCAKCTCTTTTCTCTAAAAATGAGTCTCCGGTGGCTGACAGCACACCW
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link