si:ch211-285c6.2

Ensembl ID:
ENSDARG00000079234
ZFIN ID:
ZDB-GENE-040724-168
Description:
Novel protein similar to vertebrate NIMA (Never in mitosis gene a)-related expressed kinase 1 (NEK1)
Human Orthologue:
NEK11
Human Description:
NIMA (never in mitosis gene a)- related kinase 11 [Source:HGNC Symbol;Acc:18593]
Mouse Orthologue:
Nek11
Mouse Description:
NIMA (never in mitosis gene a)-related expressed kinase 11 Gene [Source:MGI Symbol;Acc:MGI:2442276]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40824 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40824
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114070   None 248 None 3
ENSDART00000122334 Essential Splice Site 567 576 11 12
ENSDART00000138247   None 251 None 9
ENSDART00000144363   None 105 None 4
Genomic Location (Zv9):
Chromosome 7 (position 3628532)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 3318946
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGTTGAGACTCAAACCTGTGACCTTGCTGTGGGGCAACAGTTCTATGT[G/T]AATATAAATGTCTTTCGAGATGAAAGTAGTTGCTAGTCACCAGTTCTCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link