si:dkey-103j14.2

Ensembl ID:
ENSDARG00000079230
ZFIN ID:
ZDB-GENE-090313-168
Description:
Novel protein similar to vertebrate sorbin and SH3 domain containing family [Source:UniProtKB/TrEMBL
Human Orthologue:
SORBS1
Human Description:
sorbin and SH3 domain containing 1 [Source:HGNC Symbol;Acc:14565]
Mouse Orthologue:
Sorbs1
Mouse Description:
sorbin and SH3 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:700014]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1288 Nonsense F2 line generated During 2017
sa17635 Nonsense Available for shipment Available now
sa11347 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1288
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004908 Nonsense 369 580 19 25
ENSDART00000043870 Nonsense 290 501 12 18
ENSDART00000135678   None 136 None 6
ENSDART00000137040 Nonsense 527 659 19 21
ENSDART00000138732   None 151 None 5

The following transcripts of ENSDARG00000079230 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 23435281)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23080941
KASP Assay ID:
554-1203.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTTTTATTAGGGAACTTCCATTTCAGAAGGGAGATATAGTATACATCTA[T/A]CGGCAGGTCGATCAGAACTGGTTTGAAGGAGAGCATCATGGGAGAGTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17635
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004908 Nonsense 392 580 19 25
ENSDART00000043870 Nonsense 313 501 12 18
ENSDART00000135678   None 136 None 6
ENSDART00000137040 Nonsense 550 659 19 21
ENSDART00000138732   None 151 None 5

The following transcripts of ENSDARG00000079230 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 23435350)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23081010
KASP Assay ID:
2260-6361.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTTTGAAGGAGAGCAWCATGGGAGAGTTGGGATTTTTCCACGKAGTTA[T/A]GTTGAGGTACTTTATATCYTTAACTAAYATGTTTTGTATGCTTTCAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11347
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004908 Nonsense 556 580 24 25
ENSDART00000043870 Nonsense 477 501 17 18
ENSDART00000135678   None 136 None 6
ENSDART00000137040   None 659 None 21
ENSDART00000138732 Nonsense 127 151 4 5

The following transcripts of ENSDARG00000079230 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 13 (position 23444542)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 23090202
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGCAGGAAGGAGACCTGGTCAAYGTCATGGAGAAATGTGATGATGGCTG[G/A]TTTGTGGGTATGTGTCATTTATTATTATATTGATTCTCCATGAAAAGTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link