ENSDARG00000079226

Ensembl ID:
ENSDARG00000079226
Human Orthologue:
PCDH15
Human Description:
protocadherin-related 15 [Source:HGNC Symbol;Acc:14674]
Mouse Orthologue:
Pcdh15
Mouse Description:
protocadherin 15 Gene [Source:MGI Symbol;Acc:MGI:1891428]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25681 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25681
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112787 Nonsense 715 1111 10 18
Genomic Location (Zv9):
Chromosome 1 (position 54113173)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 52923664
KASP Assay ID:
2259-1186.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCAAAATTGCTTCTCTCTCTGAGAGTGTGTCTTTTGAGAGTTCCTCCTA[C/A]AACTTCATGATCAAGGAGAATGAACCCGAGGAGACAATAGTAGGCACGGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link