bbs9

Ensembl ID:
ENSDARG00000079217
Human Orthologue:
BBS9
Human Description:
Bardet-Biedl syndrome 9 [Source:HGNC Symbol;Acc:30000]
Mouse Orthologue:
Bbs9
Mouse Description:
Bardet-Biedl syndrome 9 (human) Gene [Source:MGI Symbol;Acc:MGI:2442833]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14425 Nonsense Available for shipment Available now
sa18653 Nonsense Available for shipment Available now
sa22748 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14425
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111308 Nonsense 121 877 4 20
Genomic Location:
Chromosome 16 (position 8181604)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTATGGTTTTCTCAGGYACYGCCGGTAATGTTGAAYATGGKGACCAGTA[T/A]CAGCTGCGACTGGTKTATGAACACAACCTGCAGAGAACAGCTTGCAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18653
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111308 Nonsense 220 877 6 20
Genomic Location:
Chromosome 16 (position 8186074)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAATTCAGATACGAGACGCTGGCTGTGGCCACAGATGCAGACACCAAA[C/T]AAGACTCGAATCAGCAAAGCAAGAGCTCAGGAAAAAGACTGACTGTGYGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22748
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111308 Nonsense 722 877 18 20
Genomic Location:
Chromosome 16 (position 8267755)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGACGCAGCAGAGGACAACCGTGAGCGTTTGATCCAGGCGTTTGCACGTT[T/G]ACGGAGCGCGACTCACCTCCTCATCCTGCTGCTGTCTCTGTGGCAGGGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mzu3r56n