ENSDARG00000079210

Ensembl ID:
ENSDARG00000079210
Human Orthologues:
ART1, ART3, ART4, ART5
Human Descriptions:
ADP-ribosyltransferase 1 [Source:HGNC Symbol;Acc:723]
ADP-ribosyltransferase 3 [Source:HGNC Symbol;Acc:725]
ADP-ribosyltransferase 4 (Dombrock blood group) [Source:HGNC Symbol;Acc:726]
ADP-ribosyltransferase 5 [Source:HGNC Symbol;Acc:24049]
Mouse Orthologues:
Art1, Art2b, Art3, Art4, Art5
Mouse Descriptions:
ADP-ribosyltransferase 1 Gene [Source:MGI Symbol;Acc:MGI:107511]
ADP-ribosyltransferase 2b Gene [Source:MGI Symbol;Acc:MGI:107545]
ADP-ribosyltransferase 3 Gene [Source:MGI Symbol;Acc:MGI:1202729]
ADP-ribosyltransferase 4 Gene [Source:MGI Symbol;Acc:MGI:1202710]
ADP-ribosyltransferase 5 Gene [Source:MGI Symbol;Acc:MGI:107948]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33090 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa33090
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114541 Nonsense 133 312 3 3
Genomic Location (Zv9):
Chromosome 3 (position 7894785)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 8310727
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCCAGAAAATCCACGGAATCGTACACGCTTAATTGCCATTTACGTGTA[C/A]ACTGACAGGATTGCATATGCAGACTTCAATAAAGCTGTTCGAAGCGGTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link