adam11

Ensembl ID:
ENSDARG00000079204
ZFIN ID:
ZDB-GENE-070808-3
Human Orthologue:
ADAM11
Human Description:
ADAM metallopeptidase domain 11 [Source:HGNC Symbol;Acc:189]
Mouse Orthologue:
Adam11
Mouse Description:
a disintegrin and metallopeptidase domain 11 Gene [Source:MGI Symbol;Acc:MGI:1098667]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22056 Nonsense Mutation detected in F1 DNA During 2014
sa5598 Essential Splice Site F2 line generated During 2014
sa2649 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa22056
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110503 Nonsense 91 774 3 27
Genomic Location:
Chromosome 12 (position 14974096)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCTCAGCCCATTCATCTTGCTCAAATCACATTCCTGGTAAAGGCCTTT[G/T]GAATACCATTTGTTTTGGACCTGGAGCTCAATCAGTATGTGCAAAATCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5598
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110503 Essential Splice Site 334 774 11 27
ENSDART00000110503 Essential Splice Site 334 774 11 27
Genomic Location:
Chromosome 12 (position 14944424)
KASP Assay ID:
554-3154.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGAAGGAGAATATYAAAGAGAAGAGTGACACAGCTCACCTSCTCTCG[T/C]ATGTTACACTTCCCTCTAGTTCTGAACTGGACTAGTCTAGGWTTKAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2649
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110503 Essential Splice Site 334 774 11 27
ENSDART00000110503 Essential Splice Site 334 774 11 27
Genomic Location:
Chromosome 12 (position 14944424)
KASP Assay ID:
554-3154.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGGAAGGAGAATATYAAAGAGAAGAGTGACACAGCTCACCTSCTCTCG[T/C]ATGTTACACTTCCCTCTAGTTCTGAACTGGACTAGTCTAGGWTTKAACTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/w4g8qzh9