parp2

Ensembl ID:
ENSDARG00000079202
ZFIN ID:
ZDB-GENE-031113-6
Description:
LOC100007906 protein [Source:UniProtKB/TrEMBL;Acc:A5PLJ8]
Human Orthologue:
PARP2
Human Description:
poly (ADP-ribose) polymerase 2 [Source:HGNC Symbol;Acc:272]
Mouse Orthologue:
Parp2
Mouse Description:
poly (ADP-ribose) polymerase family, member 2 Gene [Source:MGI Symbol;Acc:MGI:1341112]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6855 Nonsense Mutation detected in F1 DNA During 2017
sa9953 Nonsense Available for shipment Available now
sa14277 Nonsense Available for shipment Available now
sa31291 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6855
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113337 Nonsense 3 649 1 17
ENSDART00000136796   None 271 None 9
ENSDART00000143203 Nonsense 3 649 2 18
Genomic Location (Zv9):
Chromosome 2 (position 37575997)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37855129
KASP Assay ID:
554-4540.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTTTTGACGTTTTCTCCTAATTTTAGCTGTTTTCCGGGAACATGCGA[C/T]GAACAAGGAGTTGCAGGGACARGTCTGTGGCAGATTCAGGCAGTGAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9953
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113337 Nonsense 83 649 2 17
ENSDART00000136796 Nonsense 12 271 1 9
ENSDART00000143203 Nonsense 83 649 3 18
Genomic Location (Zv9):
Chromosome 2 (position 37576702)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37855834
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGTGGATCTTGTGAAAATGACTCAGACTAATACTGTCAGCAAGTACAAA[C/T]GAAAAATACGCCTTCAGAAAGTGAAGTCAGGTACGTCTRCGTGCTTCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14277
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113337 Nonsense 320 649 9 17
ENSDART00000136796 Nonsense 248 271 8 9
ENSDART00000143203 Nonsense 320 649 10 18
Genomic Location (Zv9):
Chromosome 2 (position 37579765)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37858897
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCAGTCTCTCCTAGAGCTCATTTGTGATCTCAAAGCCATGGAGGAGTG[T/A]GTGCTGGAGATGAAGTTTGACACCAAAAAAGCCCCACTCGGTGTGTGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31291
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113337 Nonsense 535 649 15 17
ENSDART00000136796   None 271 None 9
ENSDART00000143203 Nonsense 535 649 16 18
Genomic Location (Zv9):
Chromosome 2 (position 37582422)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 37861554
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCATTCTGTCTAGTTTGGTAAGGGGATCTATTTCGCAGACATGTCATCC[A/T]AAAGTGCCAATTACTGCTTTGCCAGTCAGAAGAACAACCAGGGACTCTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link