LOC100332862

Ensembl ID:
ENSDARG00000079201
Human Orthologue:
TSHZ2
Human Description:
teashirt zinc finger homeobox 2 [Source:HGNC Symbol;Acc:13010]
Mouse Orthologue:
Tshz2
Mouse Description:
teashirt zinc finger family member 2 Gene [Source:MGI Symbol;Acc:MGI:2153084]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16736 Nonsense Available for shipment Available now
sa15781 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16736
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109493 Nonsense 337 1016 1 1
Genomic Location:
Chromosome 23 (position 38447513)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGCCACAAGGCCTTGTTCGCCYGACTCAACCACAGGGGTTTCAGGTTA[C/A]ACCGATGYCCAAAGGTYGTCCGGCCTTGCCAATGCTCCCAACAACCGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15781
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109493 Nonsense 364 1016 1 1
Genomic Location:
Chromosome 23 (position 38447593)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAATGCTCCCAACAACCGCTAYGGCTATCAGAACGGTGCTAGTTACACAT[G/A]GCAGTTTGAGACGTGCAAATCTCAGATCCTGAAGTGCATGGAGTGCGGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/9f7lgys3