megf6a

Ensembl ID:
ENSDARG00000079199
ZFIN ID:
ZDB-GENE-090312-12
Human Orthologue:
MEGF6
Human Description:
multiple EGF-like-domains 6 [Source:HGNC Symbol;Acc:3232]
Mouse Orthologue:
Megf6
Mouse Description:
multiple EGF-like-domains 6 Gene [Source:MGI Symbol;Acc:MGI:1919351]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37685 Nonsense Mutation detected in F1 DNA During 2016
sa37684 Essential Splice Site Mutation detected in F1 DNA During 2016
sa37683 Essential Splice Site Mutation detected in F1 DNA During 2016
sa15011 Nonsense Available for shipment Available now
sa18274 Nonsense Available for shipment Available now
sa16632 Nonsense Available for shipment Available now
sa11308 Essential Splice Site Available for shipment Available now
sa9745 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37685
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112424 Nonsense 101 1513 3 36
ENSDART00000143206   None 1446 None 34
Genomic Location:
Chromosome 23 (position 21549360)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTACAGGCAGGACTTCAAGATGGCATACAAATGCTGTCCTGGATGGTCC[C/T]AGAACAATTCAAAGATGGGCTGCCTTTATCGTAAGTGTTTCCACTATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37684
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112424 Essential Splice Site 322 1513 9 36
ENSDART00000143206 Essential Splice Site 265 1446 7 34
Genomic Location:
Chromosome 23 (position 21458387)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGCTAGTTTTTATTTTTAATCCTTTTTCATTTATTGCCTTTGCTTTGT[A/T]GATCTGGAGGAATGTGAGGAAGGAACGTCATGCTGTGAGCAGGATTGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37683
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112424 Essential Splice Site 547 1513 13 36
ENSDART00000143206 Essential Splice Site 490 1446 11 34
Genomic Location:
Chromosome 23 (position 21454099)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGAAGTGCCGCTGCCCACCTGGAGTCAATGGAGACCTGTGCCAGGACGG[T/C]GAGTGACTGAATAAAATGAACACCTATCTGTGCCAAATCTGATGTTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15011
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112424 Nonsense 548 1513 14 36
ENSDART00000143206 Nonsense 491 1446 12 34
Genomic Location:
Chromosome 23 (position 21453216)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCTTCAYATAAAAGCWGAAAGTAATCTGTACACTTTGTTCTTTAGGCTG[T/A]CCGAAGGGAATGTATGGAAAGCACTGCAACAAGAAATGTAACTGTGCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18274
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112424 Nonsense 604 1513 15 36
ENSDART00000143206 Nonsense 547 1446 13 34
Genomic Location:
Chromosome 23 (position 21448614)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTCCAGCTTGCCCCAAGTGGTCRTATGGATCTGGCTGCTCATCCGAGTG[T/A]CAGTGTKTGCAACAAAACAYGCTTGAGTGCCATCGACGTCATGGAACGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16632
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112424 Nonsense 906 1513 22 36
ENSDART00000143206 Nonsense 849 1446 20 34
Genomic Location:
Chromosome 23 (position 21436279)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATATATTCATCTCAAACAGCWTGTCCTGAGGGCTTTCATGGCTTGGAGTG[C/A]CAGCAGAAGTGYCAGTGCTTGAATGGTGRCCRTTGTCATCCCGTGACTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11308
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112424 Essential Splice Site 1025 1513 24 36
ENSDART00000143206 Essential Splice Site 968 1446 22 34
Genomic Location:
Chromosome 23 (position 21433173)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCACTGCACATGTGTCAGTGGGTGGACAGGAGTGGCCTGTGAATTGGG[T/G]AAAGCACAGACCCAACACACTGTAGTAACTCCAACAGCTGCTGGCAATCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9745
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112424 Nonsense 1356 1513 32 36
ENSDART00000143206 Nonsense 1299 1446 30 34
Genomic Location:
Chromosome 23 (position 21418520)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTGTGACTGTARGAATAACAGCACATGCGACCGAGTGACKGGCGTCTG[T/A]CTCTGCTCTCCAKGTTTCTACGGACATCTATGTCAACATGGTGAATGATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link