usp13

Ensembl ID:
ENSDARG00000079198
ZFIN ID:
ZDB-GENE-080724-7
Description:
ubiquitin carboxyl-terminal hydrolase 13 [Source:RefSeq peptide;Acc:NP_001091856]
Human Orthologue:
USP13
Human Description:
ubiquitin specific peptidase 13 (isopeptidase T-3) [Source:HGNC Symbol;Acc:12611]
Mouse Orthologue:
Usp13
Mouse Description:
ubiquitin specific peptidase 13 (isopeptidase T-3) Gene [Source:MGI Symbol;Acc:MGI:1919857]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33881 Nonsense Mutation detected in F1 DNA During 2016
sa17094 Nonsense Available for shipment Available now
sa15297 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33881
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065293 Nonsense 44 860 2 21
Genomic Location (Zv9):
Chromosome 6 (position 29128580)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 29424223
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTTTATTCTGGTTTCATTATTTCTCTAGGAATCAGAAGGTGGTCTGTA[T/A]GTGTGTATGAACTCATTCCTGGGTTTTGGAAGAGAACACGTGGAGAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17094
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065293 Nonsense 592 860 15 21
Genomic Location (Zv9):
Chromosome 6 (position 29159505)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 29455148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGTGNNNNNNNNNTTTTTTTTTTGTTACAGATATGTCAGTAGATGTACCTGATTTCT[T/A]GGATCTGAATCGCCTTAGAGCCACAGGTCTACAGGCTGGAGAAGAGGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15297
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065293 Nonsense 848 860 21 21
Genomic Location (Zv9):
Chromosome 6 (position 29180203)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 29475846
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTTAYAATGACCATAAAGTATGTTTGTCAGAGAGGCCTCCTAAAGACT[T/A]GGGCTACATGTAYTTTTACCGGCGCCTGTCAAGCTGCTAAACCTRGACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link