usp13

Ensembl ID:
ENSDARG00000079198
ZFIN ID:
ZDB-GENE-080724-7
Description:
ubiquitin carboxyl-terminal hydrolase 13 [Source:RefSeq peptide;Acc:NP_001091856]
Human Orthologue:
USP13
Human Description:
ubiquitin specific peptidase 13 (isopeptidase T-3) [Source:HGNC Symbol;Acc:12611]
Mouse Orthologue:
Usp13
Mouse Description:
ubiquitin specific peptidase 13 (isopeptidase T-3) Gene [Source:MGI Symbol;Acc:MGI:1919857]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17094 Nonsense Available for shipment Available now
sa15297 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17094
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065293 Nonsense 592 860 15 21
Genomic Location:
Chromosome 6 (position 29159505)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGTGNNNNNNNNNTTTTTTTTTTGTTACAGATATGTCAGTAGATGTACCTGATTTCT[T/A]GGATCTGAATCGCCTTAGAGCCACAGGTCTACAGGCTGGAGAAGAGGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15297
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065293 Nonsense 848 860 21 21
Genomic Location:
Chromosome 6 (position 29180203)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATTTAYAATGACCATAAAGTATGTTTGTCAGAGAGGCCTCCTAAAGACT[T/A]GGGCTACATGTAYTTTTACCGGCGCCTGTCAAGCTGCTAAACCTRGACCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/lja87nar