ptmab

Ensembl ID:
ENSDARG00000079193
ZFIN ID:
ZDB-GENE-030131-8681
Description:
Prothymosin alpha-B [Source:UniProtKB/Swiss-Prot;Acc:A5PLC8]
Human Orthologues:
AL158827.1, PTMA
Human Descriptions:
prothymosin, alpha [Source:HGNC Symbol;Acc:9623]
Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:C9K018]
Mouse Orthologue:
Ptma
Mouse Description:
prothymosin alpha Gene [Source:MGI Symbol;Acc:MGI:97803]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38220 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38220
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111160 Nonsense 88 106 4 5
Genomic Location (Zv9):
Chromosome Zv9_NA883 (position 35526)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150442.1 35526
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGATGATGAAGACCTAGGTGGAGGAACAAAGCGGGGTGCTGATGATGAT[G/T]AAGATGAGGATGAAGATGATGAGGTACCATCATTATTTCTGGAGTCATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link