NPAS3

Ensembl ID:
ENSDARG00000079182
Description:
neuronal PAS domain protein 3 [Source:HGNC Symbol;Acc:19311]
Human Orthologue:
NPAS3
Human Description:
neuronal PAS domain protein 3 [Source:HGNC Symbol;Acc:19311]
Mouse Orthologue:
Npas3
Mouse Description:
neuronal PAS domain protein 3 Gene [Source:MGI Symbol;Acc:MGI:1351610]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28812 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36329 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa28812
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007777 Essential Splice Site 194 978 4 12
Genomic Location (Zv9):
Chromosome 17 (position 9461920)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 9444009
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGGCCTCAGACATCTTTGAGCCTCACCTCGGCAGCCACATCCTGCAGG[T/C]AAGAGGAAATTTAAACCATCTCTGACCATGCACCTATACTGCAGTGTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36329
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007777 Nonsense 346 978 8 12
Genomic Location (Zv9):
Chromosome 17 (position 9681855)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 9703414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGCTGCGGATAAGAATGGCATTAACGCACAGTCGTTCGGTACCCAAT[C/T]AAATCATGGGCATGGTTGTGGTGGCACACGCACTTCCTCCACCAACCATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link