BSN (1 of 2)

Ensembl ID:
ENSDARG00000079161
Description:
bassoon (presynaptic cytomatrix protein) [Source:HGNC Symbol;Acc:1117]
Human Orthologue:
BSN
Human Description:
bassoon (presynaptic cytomatrix protein) [Source:HGNC Symbol;Acc:1117]
Mouse Orthologue:
Bsn
Mouse Description:
bassoon Gene [Source:MGI Symbol;Acc:MGI:1277955]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21962 Nonsense Available for shipment Available now
sa41897 Nonsense Mutation detected in F1 DNA During 2018
sa41896 Nonsense Mutation detected in F1 DNA During 2018
sa41895 Nonsense Mutation detected in F1 DNA During 2018
sa41894 Nonsense Mutation detected in F1 DNA During 2018
sa41893 Nonsense Mutation detected in F1 DNA During 2018
sa6219 Nonsense Mutation detected in F1 DNA During 2018
sa7352 Missense Mutation detected in F1 DNA During 2018
sa21961 Nonsense Available for shipment Available now
sa16951 Nonsense Available for shipment Available now
sa21960 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21962
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109753 Nonsense 91 3142 1 13
ENSDART00000127184 Nonsense 91 3123 1 14
ENSDART00000127987 Nonsense 84 3144 2 16
Genomic Location (Zv9):
Chromosome 11 (position 38372723)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 37184721
GRCz11 11 37451926
KASP Assay ID:
2260-4592.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCCAGTAAAACAAGGGGCACCACAATCCAAGGGCCCCTCTCAACAAT[T/A]ACCTGCAACTAAGACTGACACAAAAAAACAAGATCAAGGAAATAACAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41897
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109753 Nonsense 756 3142 3 13
ENSDART00000127184 Nonsense 756 3123 3 14
ENSDART00000127987 Nonsense 766 3144 5 16
Genomic Location (Zv9):
Chromosome 11 (position 38370223)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 37182221
GRCz11 11 37449426
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCGGAGCTTCCTCTTTAACATCAAAAATGTTCTCATATTTCAAAGGAT[C/A]AAGTCCTTCAACATCCCCCTCTACTTCCCCCACACACAGTCCAACACGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41896
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109753 Nonsense 1018 3142 3 13
ENSDART00000127184 Nonsense 1018 3123 3 14
ENSDART00000127987 Nonsense 1028 3144 5 16
Genomic Location (Zv9):
Chromosome 11 (position 38369436)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 37181434
GRCz11 11 37448639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTGGCAGCATCTATGTTCATATCACAGCCAAAGCAACCAGTTGTATA[T/A]GGGGATCCTTTGCAAAATAGAGTCGACTTTGGCCAAGGAGTTGGATCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41895
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109753 Nonsense 1114 3142 4 13
ENSDART00000127184 Nonsense 1114 3123 4 14
ENSDART00000127987 Nonsense 1124 3144 6 16
Genomic Location (Zv9):
Chromosome 11 (position 38369064)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 37181062
GRCz11 11 37448267
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTAGTTCTATTGCCAAAATATCCCCGCTACCTCCACCACCATTATCATG[C/A]TCCGCATCTACCACACCCACACTTGGTCATGACATATATGGTGGAGTGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41894
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109753 Nonsense 1329 3142 5 13
ENSDART00000127184 Nonsense 1328 3123 5 14
ENSDART00000127987 Nonsense 1331 3144 7 16
Genomic Location (Zv9):
Chromosome 11 (position 38368374)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 37180372
GRCz11 11 37447577
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTTACCTTTGAGAAGATATGGTTCAATGTCGAATATAAATGCAGAATA[T/G]GGCTATCCTCCACGTGATCTTGGTGGTTTTCAAGAATCTAATCTTGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41893
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109753 Nonsense 1512 3142 5 13
ENSDART00000127184 Nonsense 1511 3123 5 14
ENSDART00000127987 Nonsense 1514 3144 7 16
Genomic Location (Zv9):
Chromosome 11 (position 38367825)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 37179823
GRCz11 11 37447028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCAAGTCACCCCAAGAATGCCTCTAAATGCCCAGGCACCTTACAGATA[T/A]CCTCCTCCAAATCAGTTTTCAGCAACTGCTCCAGAAACTTTATCAGGAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6219
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109753 Nonsense 1642 3142 6 13
ENSDART00000127184 Nonsense 1634 3123 6 14
ENSDART00000127987 Nonsense 1630 3144 9 16
Genomic Location (Zv9):
Chromosome 11 (position 38367344)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 37179342
GRCz11 11 37446547
KASP Assay ID:
554-5454.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTGCAGATACTGAGAAGGAAAAAGAAGAAGAAAGATTGCGACAACAG[C/T]AGGAGCAACTCTTGCAGCTAGAACGAGAACGTGTTGAGTTGGAGAAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7352
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109753 Missense 1965 3142 7 13
ENSDART00000127184 Missense 1957 3123 7 14
ENSDART00000127987 Missense 1953 3144 10 16
Genomic Location (Zv9):
Chromosome 11 (position 38366312)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 37178310
GRCz11 11 37445515
KASP Assay ID:
554-4116.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACCATGGCTGAAACATCAAAGGTTGAACTCCTTCACTACATATCTGCT[C/T]CAGAAAGAACCCRTAAGGGAGAGAGTTTAGCATGCCAAACTGATCCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21961
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109753 Nonsense 2181 3142 8 13
ENSDART00000127184 Nonsense 2173 3123 8 14
ENSDART00000127987 Nonsense 2169 3144 11 16
Genomic Location (Zv9):
Chromosome 11 (position 38364631)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 37176629
GRCz11 11 37443834
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATTATGACACCAGCAATTCCCCATATATACAGTTCCCCTGGGGTATCC[C/T]AAAGGGTTTTGCCACGTACTGCACAGGGTGCAATGAAAGCAGGCTTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16951
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109753 Nonsense 2642 3142 9 13
ENSDART00000127184 Nonsense 2638 3123 9 14
ENSDART00000127987 Nonsense 2630 3144 12 16
Genomic Location (Zv9):
Chromosome 11 (position 38363144)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 37175142
GRCz11 11 37442347
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGTGTCCAGGACTGGTGTGAAAAAAGGCTATGACCAGCAGAAGTACTA[T/A]GGATCAAGGGAGGCATTGGAAGAGGAYGATCGCCTCTATGGCTCTGGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21960
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109753 Nonsense 3008 3142 10 13
ENSDART00000127184 Nonsense 2994 3123 11 14
ENSDART00000127987 Nonsense 2996 3144 13 16
Genomic Location (Zv9):
Chromosome 11 (position 38361669)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 37173667
GRCz11 11 37440872
KASP Assay ID:
2260-4587.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAATTGGGACAGACAACCCGTACACAACAGCAGCCACTACAGCATCCT[G/T]GACAACAGCCAGCGACCACAATGGGAGCAAGTCAGCCCACAACCACAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Type 2 diabetes: Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link