BSN (1 of 2)

Ensembl ID:: ENSDARG00000079161
Description:: bassoon (presynaptic cytomatrix protein) [Source:HGNC Symbol;Acc:1117]
Human Orthologue:: BSN
Human Description:: bassoon (presynaptic cytomatrix protein) [Source:HGNC Symbol;Acc:1117]
Mouse Orthologue:: Bsn
Mouse Description:: bassoon Gene [Source:MGI Symbol;Acc:MGI:1277955]

Alleles

There are 6 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa21962	Nonsense	Mutation detected in F1 DNA	During 2015
sa6219	Nonsense	Mutation detected in F1 DNA	During 2015
sa7352	Missense	Mutation detected in F1 DNA	During 2015
sa21961	Nonsense	Mutation detected in F1 DNA	During 2015
sa16951	Nonsense	Available for shipment	Available now
sa21960	Nonsense	Mutation detected in F1 DNA	During 2015

Mutation Details

Allele Name:: sa21962
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000109753	Nonsense	91	3142	1	13
ENSDART00000127184	Nonsense	91	3123	1	14
ENSDART00000127987	Nonsense	84	3144	2	16

Genomic Location:: Chromosome 11 (position 38372723)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: None
Flanking Sequence:: CTCTCCAGTAAAACAAGGGGCACCACAATCCAAGGGCCCCTCTCAACAAT[T/A]ACCTGCAACTAAGACTGACACAAAAAAACAAGATCAAGGAAATAACAAGA
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa6219
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000109753	Nonsense	1642	3142	6	13
ENSDART00000127184	Nonsense	1634	3123	6	14
ENSDART00000127987	Nonsense	1630	3144	9	16

Genomic Location:: Chromosome 11 (position 38367344)
KASP Assay ID:: 554-5454.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: CATCTGCAGATACTGAGAAGGAAAAAGAAGAAGAAAGATTGCGACAACAG[C/T]AGGAGCAACTCTTGCAGCTAGAACGAGAACGTGTTGAGTTGGAGAAATTG
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa7352
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: C > T
Consequence:: Missense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000109753	Missense	1965	3142	7	13
ENSDART00000127184	Missense	1957	3123	7	14
ENSDART00000127987	Missense	1953	3144	10	16

Genomic Location:: Chromosome 11 (position 38366312)
KASP Assay ID:: 554-4116.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: TTACCATGGCTGAAACATCAAAGGTTGAACTCCTTCACTACATATCTGCT[C/T]CAGAAAGAACCCRTAAGGGAGAGAGTTTAGCATGCCAAACTGATCCAGAG
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa21961
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000109753	Nonsense	2181	3142	8	13
ENSDART00000127184	Nonsense	2173	3123	8	14
ENSDART00000127987	Nonsense	2169	3144	11	16

Genomic Location:: Chromosome 11 (position 38364631)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: None
Flanking Sequence:: CGATTATGACACCAGCAATTCCCCATATATACAGTTCCCCTGGGGTATCC[C/T]AAAGGGTTTTGCCACGTACTGCACAGGGTGCAATGAAAGCAGGCTTGTTG
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa16951
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000109753	Nonsense	2642	3142	9	13
ENSDART00000127184	Nonsense	2638	3123	9	14
ENSDART00000127987	Nonsense	2630	3144	12	16

Genomic Location:: Chromosome 11 (position 38363144)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: GTGGTGTCCAGGACTGGTGTGAAAAAAGGCTATGACCAGCAGAAGTACTA[T/A]GGATCAAGGGAGGCATTGGAAGAGGAYGATCGCCTCTATGGCTCTGGACG
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa21960
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: G > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000109753	Nonsense	3008	3142	10	13
ENSDART00000127184	Nonsense	2994	3123	11	14
ENSDART00000127987	Nonsense	2996	3144	13	16

Genomic Location:: Chromosome 11 (position 38361669)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: None
Flanking Sequence:: AACAATTGGGACAGACAACCCGTACACAACAGCAGCCACTACAGCATCCT[G/T]GACAACAGCCAGCGACCACAATGGGAGCAAGTCAGCCCACAACCACAGCT
Associated Phenotype:: Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
Type 2 diabetes: Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. (View Study)
Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

OMIM information for BSN

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: