BSN (1 of 2)
- Ensembl ID:
- ENSDARG00000079161
- Description:
- bassoon (presynaptic cytomatrix protein) [Source:HGNC Symbol;Acc:1117]
- Human Orthologue:
- BSN
- Human Description:
- bassoon (presynaptic cytomatrix protein) [Source:HGNC Symbol;Acc:1117]
- Mouse Orthologue:
- Bsn
- Mouse Description:
- bassoon Gene [Source:MGI Symbol;Acc:MGI:1277955]
Alleles
There are 11 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa21962 |
Nonsense |
Available for shipment |
Available now |
sa41897 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa41896 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa41895 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa41894 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa41893 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa6219 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa7352 |
Missense |
Mutation detected in F1 DNA |
During 2018 |
sa21961 |
Nonsense |
Available for shipment |
Available now |
sa16951 |
Nonsense |
Available for shipment |
Available now |
sa21960 |
Nonsense |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa21962
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 11 (position 38372723)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
37184721 |
GRCz11 |
11 |
37451926 |
- KASP Assay ID:
- 2260-4592.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTCTCCAGTAAAACAAGGGGCACCACAATCCAAGGGCCCCTCTCAACAAT[T/A]ACCTGCAACTAAGACTGACACAAAAAAACAAGATCAAGGAAATAACAAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41897
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 11 (position 38370223)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
37182221 |
GRCz11 |
11 |
37449426 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCCGGAGCTTCCTCTTTAACATCAAAAATGTTCTCATATTTCAAAGGAT[C/A]AAGTCCTTCAACATCCCCCTCTACTTCCCCCACACACAGTCCAACACGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41896
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 11 (position 38369436)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
37181434 |
GRCz11 |
11 |
37448639 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACTGTGGCAGCATCTATGTTCATATCACAGCCAAAGCAACCAGTTGTATA[T/A]GGGGATCCTTTGCAAAATAGAGTCGACTTTGGCCAAGGAGTTGGATCTGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41895
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 11 (position 38369064)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
37181062 |
GRCz11 |
11 |
37448267 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTTAGTTCTATTGCCAAAATATCCCCGCTACCTCCACCACCATTATCATG[C/A]TCCGCATCTACCACACCCACACTTGGTCATGACATATATGGTGGAGTGGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41894
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 11 (position 38368374)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
37180372 |
GRCz11 |
11 |
37447577 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCGTTACCTTTGAGAAGATATGGTTCAATGTCGAATATAAATGCAGAATA[T/G]GGCTATCCTCCACGTGATCTTGGTGGTTTTCAAGAATCTAATCTTGCACA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41893
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 11 (position 38367825)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
37179823 |
GRCz11 |
11 |
37447028 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTCAAGTCACCCCAAGAATGCCTCTAAATGCCCAGGCACCTTACAGATA[T/A]CCTCCTCCAAATCAGTTTTCAGCAACTGCTCCAGAAACTTTATCAGGAAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6219
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 11 (position 38367344)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
37179342 |
GRCz11 |
11 |
37446547 |
- KASP Assay ID:
- 554-5454.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CATCTGCAGATACTGAGAAGGAAAAAGAAGAAGAAAGATTGCGACAACAG[C/T]AGGAGCAACTCTTGCAGCTAGAACGAGAACGTGTTGAGTTGGAGAAATTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7352
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Missense
- Genomic Location (Zv9):
- Chromosome 11 (position 38366312)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
37178310 |
GRCz11 |
11 |
37445515 |
- KASP Assay ID:
- 554-4116.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TTACCATGGCTGAAACATCAAAGGTTGAACTCCTTCACTACATATCTGCT[C/T]CAGAAAGAACCCRTAAGGGAGAGAGTTTAGCATGCCAAACTGATCCAGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21961
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 11 (position 38364631)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
37176629 |
GRCz11 |
11 |
37443834 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGATTATGACACCAGCAATTCCCCATATATACAGTTCCCCTGGGGTATCC[C/T]AAAGGGTTTTGCCACGTACTGCACAGGGTGCAATGAAAGCAGGCTTGTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16951
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 11 (position 38363144)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
37175142 |
GRCz11 |
11 |
37442347 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GTGGTGTCCAGGACTGGTGTGAAAAAAGGCTATGACCAGCAGAAGTACTA[T/A]GGATCAAGGGAGGCATTGGAAGAGGAYGATCGCCTCTATGGCTCTGGACG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21960
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 11 (position 38361669)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
37173667 |
GRCz11 |
11 |
37440872 |
- KASP Assay ID:
- 2260-4587.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACAATTGGGACAGACAACCCGTACACAACAGCAGCCACTACAGCATCCT[G/T]GACAACAGCCAGCGACCACAATGGGAGCAAGTCAGCCCACAACCACAGCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: