BSN (1 of 2)

Ensembl ID:
ENSDARG00000079161
Description:
bassoon (presynaptic cytomatrix protein) [Source:HGNC Symbol;Acc:1117]
Human Orthologue:
BSN
Human Description:
bassoon (presynaptic cytomatrix protein) [Source:HGNC Symbol;Acc:1117]
Mouse Orthologue:
Bsn
Mouse Description:
bassoon Gene [Source:MGI Symbol;Acc:MGI:1277955]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21962 Nonsense Mutation detected in F1 DNA During 2014
sa6219 Nonsense Mutation detected in F1 DNA During 2014
sa7352 Missense Mutation detected in F1 DNA During 2014
sa21961 Nonsense Mutation detected in F1 DNA During 2014
sa16951 Nonsense Available for shipment Available now
sa21960 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa21962
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109753 Nonsense 91 3142 1 13
ENSDART00000127184 Nonsense 91 3123 1 14
ENSDART00000127987 Nonsense 84 3144 2 16
Genomic Location:
Chromosome 11 (position 38372723)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTCCAGTAAAACAAGGGGCACCACAATCCAAGGGCCCCTCTCAACAAT[T/A]ACCTGCAACTAAGACTGACACAAAAAAACAAGATCAAGGAAATAACAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6219
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109753 Nonsense 1642 3142 6 13
ENSDART00000127184 Nonsense 1634 3123 6 14
ENSDART00000127987 Nonsense 1630 3144 9 16
Genomic Location:
Chromosome 11 (position 38367344)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCTGCAGATACTGAGAAGGAAAAAGAAGAAGAAAGATTGCGACAACAG[C/T]AGGAGCAACTCTTGCAGCTAGAACGAGAACGTGTTGAGTTGGAGAAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7352
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109753 Missense 1965 3142 7 13
ENSDART00000127184 Missense 1957 3123 7 14
ENSDART00000127987 Missense 1953 3144 10 16
Genomic Location:
Chromosome 11 (position 38366312)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTACCATGGCTGAAACATCAAAGGTTGAACTCCTTCACTACATATCTGCT[C/T]CAGAAAGAACCCRTAAGGGAGAGAGTTTAGCATGCCAAACTGATCCAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21961
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109753 Nonsense 2181 3142 8 13
ENSDART00000127184 Nonsense 2173 3123 8 14
ENSDART00000127987 Nonsense 2169 3144 11 16
Genomic Location:
Chromosome 11 (position 38364631)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGATTATGACACCAGCAATTCCCCATATATACAGTTCCCCTGGGGTATCC[C/T]AAAGGGTTTTGCCACGTACTGCACAGGGTGCAATGAAAGCAGGCTTGTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16951
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109753 Nonsense 2642 3142 9 13
ENSDART00000127184 Nonsense 2638 3123 9 14
ENSDART00000127987 Nonsense 2630 3144 12 16
Genomic Location:
Chromosome 11 (position 38363144)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGTGTCCAGGACTGGTGTGAAAAAAGGCTATGACCAGCAGAAGTACTA[T/A]GGATCAAGGGAGGCATTGGAAGAGGAYGATCGCCTCTATGGCTCTGGACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21960
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109753 Nonsense 3008 3142 10 13
ENSDART00000127184 Nonsense 2994 3123 11 14
ENSDART00000127987 Nonsense 2996 3144 13 16
Genomic Location:
Chromosome 11 (position 38361669)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACAATTGGGACAGACAACCCGTACACAACAGCAGCCACTACAGCATCCT[G/T]GACAACAGCCAGCGACCACAATGGGAGCAAGTCAGCCCACAACCACAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)
  • Type 2 diabetes: Genome-wide association study of 14,000 cases of seven common diseases and 3,000 shared controls. (View Study)
  • Ulcerative colitis: Host-microbe interactions have shaped the genetic architecture of inflammatory bowel disease. (View Study)
  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3216pk6z