si:ch211-67f13.8

Ensembl ID:
ENSDARG00000079155
ZFIN ID:
ZDB-GENE-090312-114
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B8A583]
Human Orthologue:
CD276
Human Description:
CD276 molecule [Source:HGNC Symbol;Acc:19137]
Mouse Orthologue:
Cd276
Mouse Description:
CD276 antigen Gene [Source:MGI Symbol;Acc:MGI:2183926]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6322 Nonsense Mutation detected in F1 DNA During 2017
sa22349 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6322
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112898 Nonsense 97 299 2 4
ENSDART00000137297   None 45 None 4
ENSDART00000143488 Nonsense 22 154 1 2
Genomic Location (Zv9):
Chromosome 13 (position 36386065)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35858634
KASP Assay ID:
554-5305.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGCTTCTACTACAGTCGGGATCAGCTGGACCAACAATTCCCTYATTA[T/A]ATTAACCGCACCARTCTGTTCATTCAGGAGATGCAGCGWGGAAACGCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22349
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112898 Nonsense 211 299 3 4
ENSDART00000137297   None 45 None 4
ENSDART00000143488 Nonsense 136 154 2 2
Genomic Location (Zv9):
Chromosome 13 (position 36385651)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 35858220
KASP Assay ID:
2260-6730.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACACCTCAGACAGGACACACTCACAGGACTTTACATCGTGTCCAGCTG[G/A]ATAAAACTCTCTGACGTCTCAAACTCTATATTGACGTTTATTCTGCACAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link